rs1555874762

Variant names:

• chr21-46122897-TGAAAGGAGAACCTGGGAGGAAAGGAGA-T
• rs1555874762
• NM_001849.4:c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_001849.4(COL6A2):​c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA​(p.Pro548_Glu556del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: COL6A2 NM_001849.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.45
• Publications: 0 publications found

Genes affected

COL6A2 (HGNC:2212): (collagen type VI alpha 2 chain) This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]

COL6A2 Gene-Disease associations (from GenCC):

• collagen 6-related myopathy

  Inheritance: AD, SD, AR Classification: DEFINITIVE Submitted by: ClinGen
• Ullrich congenital muscular dystrophy 1B

  Inheritance: AR, AD Classification: DEFINITIVE Submitted by: G2P
• Bethlem myopathy 1A

  Inheritance: AD, AR Classification: STRONG Submitted by: Genomics England PanelApp
• Ullrich congenital muscular dystrophy 1A

  Inheritance: AR, AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• Bethlem myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Ullrich congenital muscular dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• myosclerosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001849.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001849.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL6A2	NM_001849.4	MANE Select	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28	NP_001840.3
	COL6A2	NM_058174.3	MANE Plus Clinical	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28	NP_478054.2	P12110-2
	COL6A2	NM_058175.3		c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28	NP_478055.2	P12110-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL6A2	ENST00000300527.9	TSL:1 MANE Select	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28	ENSP00000300527.4	P12110-1
	COL6A2	ENST00000397763.6	TSL:5 MANE Plus Clinical	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28	ENSP00000380870.1	P12110-2
	COL6A2	ENST00000857098.1		c.1836_1862delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro613_Glu621del	disruptive_inframe_deletion	Exon 21 of 28	ENSP00000527157.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Bethlem myopathy 1A (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555874762; hg19: chr21-47542811;