rs1555874762

Variant names:

• chr21-46122897-TGAAAGGAGAACCTGGGAGGAAAGGAGA-T
• rs1555874762
• NM_001849.4:c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_001849.4(COL6A2):​c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA​(p.Pro548_Glu556del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: COL6A2 NM_001849.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.45
• Publications: 0 publications found

Genes affected

COL6A2 (HGNC:2212): (collagen type VI alpha 2 chain) This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]

COL6A2 Gene-Disease associations (from GenCC):

• collagen 6-related myopathy

  Inheritance: AD, AR Classification: DEFINITIVE Submitted by: ClinGen
• Ullrich congenital muscular dystrophy 1B

  Inheritance: AR, AD Classification: DEFINITIVE Submitted by: G2P
• Bethlem myopathy 1A

  Inheritance: AD, AR Classification: STRONG Submitted by: Genomics England PanelApp
• Ullrich congenital muscular dystrophy 1A

  Inheritance: AD, AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• Bethlem myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Ullrich congenital muscular dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• myosclerosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001849.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COL6A2	NM_001849.4	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28	ENST00000300527.9	NP_001840.3
COL6A2	NM_058174.3	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28		NP_478054.2
COL6A2	NM_058175.3	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28		NP_478055.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COL6A2	ENST00000300527.9	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28	1	NM_001849.4	ENSP00000300527.4
COL6A2	ENST00000397763.6	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 21 of 28	5		ENSP00000380870.1
COL6A2	ENST00000409416.6	c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro548_Glu556del	disruptive_inframe_deletion	Exon 20 of 27	5		ENSP00000387115.1
COL6A2	ENST00000413758.1	c.264_290delACCTGGGAGGAAAGGAGAGAAAGGAGA	p.Pro89_Glu97del	disruptive_inframe_deletion	Exon 6 of 11	3		ENSP00000395751.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Bethlem myopathy 1A Uncertain:1

Feb 24, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.1641_1667del, results in the deletion of 9 amino acid(s) of the COL6A2 protein (p.Gly549_Pro557del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with COL6A2-related conditions. ClinVar contains an entry for this variant (Variation ID: 476455). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. This variant disrupts the triple helix domain of COL6A2. Glycine residues within the Gly-Xaa-Yaa repeats of the triple helix domain are required for the structure and stability of fibrillar collagens (PMID: 7695699, 8218237, 19344236). In COL6A2, missense variants at these glycine residues are significantly enriched in individuals with autosomal dominant disease (PMID: 15689448, 24038877) compared to the general population (ExAC). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555874762; hg19: chr21-47542811;