22-18078374-GTTATGAAGAGCGATTCTTC-TGCAGCCCCCCTCAGGGGGCTCGGGG

Variant names:

• chr22-18078374-GTTATGAAGAGCGATTCTTC-TGCAGCCCCCCTCAGGGGGCTCGGGG
• NM_001127649.3:c.-3_17delGTTATGAAGAGCGATTCTTCinsTGCAGCCCCCCTCAGGGGGCTCGGGG

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1 PS1_Moderate PM2 PP5_Moderate

The NM_001127649.3(PEX26):​c.-3_17delGTTATGAAGAGCGATTCTTCinsTGCAGCCCCCCTCAGGGGGCTCGGGG​(p.Met1_Ser6delinsCysSerProProGlnGlyAlaArgGly) variant causes a start lost, disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PEX26 NM_001127649.3 start_lost, disruptive_inframe_insertion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.42

Genes affected

PEX26 (HGNC:22965): (peroxisomal biogenesis factor 26) This gene belongs to the peroxin-26 gene family. It is probably required for protein import into peroxisomes. It anchors PEX1 and PEX6 to peroxisome membranes, possibly to form heteromeric AAA ATPase complexes required for the import of proteins into peroxisomes. Defects in this gene are the cause of peroxisome biogenesis disorder complementation group 8 (PBD-CG8). PBD refers to a group of peroxisomal disorders arising from a failure of protein import into the peroxisomal membrane or matrix. The PBD group is comprised of four disorders: Zellweger syndrome (ZWS), neonatal adrenoleukodystrophy (NALD), infantile Refsum disease (IRD), and classical rhizomelic chondrodysplasia punctata (RCDP). Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2010]

ENSG00000288683 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PS1: Another start lost variant in NM_001127649.3 (PEX26) was described as [Likely_pathogenic] in Lovd
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 22-18078374-GTTATGAAGAGCGATTCTTC-TGCAGCCCCCCTCAGGGGGCTCGGGG is Pathogenic according to our data. Variant chr22-18078374-GTTATGAAGAGCGATTCTTC-TGCAGCCCCCCTCAGGGGGCTCGGGG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2934975.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PEX26	NM_001127649.3	c.-3_17delGTTATGAAGAGCGATTCTTCinsTGCAGCCCCCCTCAGGGGGCTCGGGG	p.Met1_Ser6delinsCysSerProProGlnGlyAlaArgGly	start_lost, disruptive_inframe_insertion		ENST00000399744.8	NP_001121121.1
PEX26	NM_001127649.3	c.-3_17delGTTATGAAGAGCGATTCTTCinsTGCAGCCCCCCTCAGGGGGCTCGGGG		5_prime_UTR_variant	Exon 1 of 5	ENST00000399744.8	NP_001121121.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PEX26	ENST00000399744.8	c.-3_17delGTTATGAAGAGCGATTCTTCinsTGCAGCCCCCCTCAGGGGGCTCGGGG	p.Met1_Ser6delinsCysSerProProGlnGlyAlaArgGly	start_lost, disruptive_inframe_insertion		1	NM_001127649.3	ENSP00000382648.4
PEX26	ENST00000399744	c.-3_17delGTTATGAAGAGCGATTCTTCinsTGCAGCCCCCCTCAGGGGGCTCGGGG		5_prime_UTR_variant	Exon 1 of 5	1	NM_001127649.3	ENSP00000382648.4
ENSG00000288683	ENST00000474897.6	n.-3_17delGTTATGAAGAGCGATTCTTCinsTGCAGCCCCCCTCAGGGGGCTCGGGG		non_coding_transcript_exon_variant	Exon 2 of 9	5		ENSP00000434235.2
ENSG00000288683	ENST00000474897.6	n.-3_17delGTTATGAAGAGCGATTCTTCinsTGCAGCCCCCCTCAGGGGGCTCGGGG		5_prime_UTR_variant	Exon 2 of 9	5		ENSP00000434235.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Peroxisome biogenesis disorder 7B;C3888385:Peroxisome biogenesis disorder 7A (Zellweger) Pathogenic:1

Jun 07, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant disrupts the initiator methionine in PEX26. If translation initiates from the next in-frame methionine, the PEX26 protein would no longer include the region containing the p.Gly89 amino acid residue. Other variant(s) that disrupt this residue have been observed in individuals with PEX26-related conditions (PMID: 12851857), which suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. Disruption of the initiator codon ‚Äãhas been observed in individual(s) with clinical features of Zellweger spectrum disorder (PMID: 12851857, 28944237). This variant is not present in population databases (ExAC no frequency). This sequence change affects the initiator methionine of the PEX26 mRNA. The next in-frame methionine is located at codon 96. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr22-18561140;