22-18078398-T-TCTGCAGCCCCCCTCAGGGGGCTCGGGGGACCC

Variant names:

• chr22-18078398-T-TCTGCAGCCCCCCTCAGGGGGCTCGGGGGACCC
• rs1184561035
• NM_001127649.3:c.27_58dupAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001127649.3(PEX26):​c.27_58dupAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGC​(p.Arg20GlnfsTer73) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Failed GnomAD Quality Control
• Consequence: PEX26 NM_001127649.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 4.89
• Publications: 0 publications found

Genes affected

PEX26 (HGNC:22965): (peroxisomal biogenesis factor 26) This gene belongs to the peroxin-26 gene family. It is probably required for protein import into peroxisomes. It anchors PEX1 and PEX6 to peroxisome membranes, possibly to form heteromeric AAA ATPase complexes required for the import of proteins into peroxisomes. Defects in this gene are the cause of peroxisome biogenesis disorder complementation group 8 (PBD-CG8). PBD refers to a group of peroxisomal disorders arising from a failure of protein import into the peroxisomal membrane or matrix. The PBD group is comprised of four disorders: Zellweger syndrome (ZWS), neonatal adrenoleukodystrophy (NALD), infantile Refsum disease (IRD), and classical rhizomelic chondrodysplasia punctata (RCDP). Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2010]

PEX26 Gene-Disease associations (from GenCC):

• peroxisome biogenesis disorder

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• peroxisome biogenesis disorder 7A (Zellweger)

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• peroxisome biogenesis disorder 7B

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics
• Zellweger spectrum disorders

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000288683 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 50 pathogenic variants in the truncated region.
• PP5: Variant 22-18078398-T-TCTGCAGCCCCCCTCAGGGGGCTCGGGGGACCC is Pathogenic according to our data. Variant chr22-18078398-T-TCTGCAGCCCCCCTCAGGGGGCTCGGGGGACCC is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 2677683.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001127649.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PEX26	NM_001127649.3	MANE Select	c.27_58dupAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGC	p.Arg20GlnfsTer73	frameshift	Exon 1 of 5	NP_001121121.1	Q7Z412-1
	PEX26	NM_017929.6		c.27_58dupAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGC	p.Arg20GlnfsTer73	frameshift	Exon 2 of 6	NP_060399.1	Q7Z412-1
	PEX26	NM_001199319.2		c.27_58dupAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGC	p.Arg20GlnfsTer73	frameshift	Exon 2 of 5	NP_001186248.1	Q7Z412-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PEX26	ENST00000399744.8	TSL:1 MANE Select	c.27_58dupAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGC	p.Arg20GlnfsTer73	frameshift	Exon 1 of 5	ENSP00000382648.4	Q7Z412-1
	PEX26	ENST00000329627.11	TSL:1	c.27_58dupAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGC	p.Arg20GlnfsTer73	frameshift	Exon 2 of 6	ENSP00000331106.5	Q7Z412-1
	PEX26	ENST00000428061.2	TSL:1	c.27_58dupAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGC	p.Arg20GlnfsTer73	frameshift	Exon 1 of 4	ENSP00000412441.2	Q7Z412-2

Frequencies

GnomAD3 genomes AF: 0.0000132 AC: 2 AN: 152010 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 30

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000132 AC: 2 AN: 152010 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74238

African (AFR) AF: 0.0000483 AC: 2 AN: 41410

American (AMR) AF: 0.00 AC: 0 AN: 15282

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5122

South Asian (SAS) AF: 0.00 AC: 0 AN: 4826

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10604

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67980

Other (OTH) AF: 0.00 AC: 0 AN: 2090

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Peroxisome biogenesis disorder 7B;C3888385:Peroxisome biogenesis disorder 7A (Zellweger) (2)
1	-	-	Peroxisome biogenesis disorder 7A (Zellweger) (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.9
Mutation Taster		=47/153	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1184561035; hg19: chr22-18561164;