22-19766765-C-CGCCGCGGCCGCCGCCGCCGCTGCCGCAGCT
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001379200.1(TBX1):c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC(p.Ala476_Ala485dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000661 in 151,264 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_001379200.1 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- conotruncal heart malformationsInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- DiGeorge syndromeInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- velocardiofacial syndromeInheritance: AD Classification: STRONG Submitted by: Ambry Genetics
- 22q11.2 deletion syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001379200.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TBX1 | NM_001379200.1 | MANE Select | c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC | p.Ala476_Ala485dup | conservative_inframe_insertion | Exon 7 of 7 | NP_001366129.1 | ||
| TBX1 | NM_080647.1 | c.1399_1428dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC | p.Ala467_Ala476dup | conservative_inframe_insertion | Exon 9 of 9 | NP_542378.1 | |||
| TBX1 | NM_080646.2 | c.1009+776_1009+805dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC | intron | N/A | NP_542377.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TBX1 | ENST00000649276.2 | MANE Select | c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC | p.Ala476_Ala485dup | conservative_inframe_insertion | Exon 7 of 7 | ENSP00000497003.1 | ||
| TBX1 | ENST00000332710.8 | TSL:1 | c.1399_1428dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC | p.Ala467_Ala476dup | conservative_inframe_insertion | Exon 9 of 9 | ENSP00000331791.4 | ||
| TBX1 | ENST00000329705.11 | TSL:1 | c.1009+776_1009+805dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC | intron | N/A | ENSP00000331176.7 |
Frequencies
GnomAD3 genomes AF: 0.00000661 AC: 1AN: 151264Hom.: 0 Cov.: 33 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000228 AC: 3AN: 1318652Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 651546 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000661 AC: 1AN: 151264Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1AN XY: 73844 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at