22-19766765-CGCCGCGGCCGCCGCCGCCGCTGCCGCAGCT-CGCCGCGGCCGCCGCCGCCGCTGCCGCAGCTGCCGCGGCCGCCGCCGCCGCTGCCGCAGCT

Position:

• chr22-19766765-CGCCGCGGCCGCCGCCGCCGCTGCCGCAGCT-CGCCGCGGCCGCCGCCGCCGCTGCCGCAGCTGCCGCGGCCGCCGCCGCCGCTGCCGCAGCT

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_001379200.1(TBX1):​c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC​(p.Ala476_Ala485dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000661 in 151,264 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000023 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TBX1 NM_001379200.1 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts P:1 U:2
• Conservation: PhyloP100: 0.513

Genes affected

TBX1 (HGNC:11592): (T-box transcription factor 1) This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product shares 98% amino acid sequence identity with the mouse ortholog. DiGeorge syndrome (DGS)/velocardiofacial syndrome (VCFS), a common congenital disorder characterized by neural-crest-related developmental defects, has been associated with deletions of chromosome 22q11.2, where this gene has been mapped. Studies using mouse models of DiGeorge syndrome suggest a major role for this gene in the molecular etiology of DGS/VCFS. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_001379200.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TBX1	NM_001379200.1	c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC	p.Ala476_Ala485dup	conservative_inframe_insertion	7/7	ENST00000649276.2	NP_001366129.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TBX1	ENST00000649276.2	c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC	p.Ala476_Ala485dup	conservative_inframe_insertion	7/7		NM_001379200.1	ENSP00000497003.1
TBX1	ENST00000332710.8	c.1399_1428dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC	p.Ala467_Ala476dup	conservative_inframe_insertion	9/9	1		ENSP00000331791.4
TBX1	ENST00000329705.11	c.1009+776_1009+805dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC		intron_variant		1		ENSP00000331176.7
TBX1	ENST00000359500.7	c.1009+776_1009+805dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC		intron_variant		1		ENSP00000352483.3

Frequencies

GnomAD3 genomes AF: 0.00000661 AC: 1 AN: 151264 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000244

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000228 AC: 3 AN: 1318652 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 651546

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000284

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000661 AC: 1 AN: 151264 Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1 AN XY: 73844

Gnomad4 AFR AF: 0.0000244

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Pathogenic:1 Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Tetralogy of Fallot Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

May 01, 2010

- -

DiGeorge syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 02, 2023

ClinVar contains an entry for this variant (Variation ID: 504072). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies have shown that this variant affects TBX1 function (PMID: 19948535). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. This variant has been observed in individual(s) with TBX1-related conditions (PMID: 19948535). This variant is not present in population databases (gnomAD no frequency). This variant, c.1399_1428dup, results in the insertion of 10 amino acid(s) of the TBX1 protein (p.Ala467_Ala476dup), but otherwise preserves the integrity of the reading frame. -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Apr 07, 2021

Reported previously in a patient with interrupted aortic arch, but segregation information was not available on this individual (Gong et al., 2001); please note that this variant is referred to as 1399-1427dup30bp (466-476dup10Ala) using alternate nomenclature; In-frame duplication of ten amino acids from Alanine 467 to Alanine 476, denoted p.Ala467_Ala476dup; Not observed in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 11748311, 19948535) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs746335599; hg19: chr22-19754288;