22-19766765-CGCCGCGGCCGCCGCCGCCGCTGCCGCAGCT-CGCCGCGGCCGCCGCCGCCGCTGCCGCAGCTGCCGCGGCCGCCGCCGCCGCTGCCGCAGCT

Variant names:

• chr22-19766765-C-CGCCGCGGCCGCCGCCGCCGCTGCCGCAGCT
• rs746335599
• NM_001379200.1:c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001379200.1(TBX1):​c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC​(p.Ala476_Ala485dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000661 in 151,264 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000023 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TBX1 NM_001379200.1 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts P:1 U:2
• Conservation: PhyloP100: 0.513
• Publications: 0 publications found

Genes affected

TBX1 (HGNC:11592): (T-box transcription factor 1) This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product shares 98% amino acid sequence identity with the mouse ortholog. DiGeorge syndrome (DGS)/velocardiofacial syndrome (VCFS), a common congenital disorder characterized by neural-crest-related developmental defects, has been associated with deletions of chromosome 22q11.2, where this gene has been mapped. Studies using mouse models of DiGeorge syndrome suggest a major role for this gene in the molecular etiology of DGS/VCFS. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

TBX1 Gene-Disease associations (from GenCC):

• conotruncal heart malformations

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• DiGeorge syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• velocardiofacial syndrome

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics
• 22q11.2 deletion syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001379200.1

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001379200.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBX1	NM_001379200.1	MANE Select	c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC	p.Ala476_Ala485dup	conservative_inframe_insertion	Exon 7 of 7	NP_001366129.1
	TBX1	NM_080647.1		c.1399_1428dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC	p.Ala467_Ala476dup	conservative_inframe_insertion	Exon 9 of 9	NP_542378.1
	TBX1	NM_080646.2		c.1009+776_1009+805dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC		intron	N/A	NP_542377.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBX1	ENST00000649276.2	MANE Select	c.1426_1455dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC	p.Ala476_Ala485dup	conservative_inframe_insertion	Exon 7 of 7	ENSP00000497003.1
	TBX1	ENST00000332710.8	TSL:1	c.1399_1428dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC	p.Ala467_Ala476dup	conservative_inframe_insertion	Exon 9 of 9	ENSP00000331791.4
	TBX1	ENST00000329705.11	TSL:1	c.1009+776_1009+805dupGCCGCCGCTGCCGCAGCTGCCGCGGCCGCC		intron	N/A	ENSP00000331176.7

Frequencies

GnomAD3 genomes AF: 0.00000661 AC: 1 AN: 151264 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000244

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000228 AC: 3 AN: 1318652 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 651546

African (AFR) AF: 0.00 AC: 0 AN: 25766

American (AMR) AF: 0.00 AC: 0 AN: 21964

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 21586

East Asian (EAS) AF: 0.00 AC: 0 AN: 30824

South Asian (SAS) AF: 0.00 AC: 0 AN: 70342

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 33076

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4468

European-Non Finnish (NFE) AF: 0.00000284 AC: 3 AN: 1056180

Other (OTH) AF: 0.00 AC: 0 AN: 54446

GnomAD4 genome AF: 0.00000661 AC: 1 AN: 151264 Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1 AN XY: 73844

African (AFR) AF: 0.0000244 AC: 1 AN: 41066

American (AMR) AF: 0.00 AC: 0 AN: 15232

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3458

East Asian (EAS) AF: 0.00 AC: 0 AN: 5134

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10508

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67746

Other (OTH) AF: 0.00 AC: 0 AN: 2074

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	DiGeorge syndrome (1)
-	1	-	not provided (1)
1	-	-	Tetralogy of Fallot (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.51
Mutation Taster		=76/24	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs746335599; hg19: chr22-19754288;