22-26483980-G-GGAGGCGGCGCCCCGGGGGAGA
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_001013694.3(SRRD):c.129_149dupGAGAGAGGCGGCGCCCCGGGG(p.Gly50_Pro51insArgGluAlaAlaProArgGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. G50G) has been classified as Likely benign.
Frequency
Consequence
NM_001013694.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Hermansky-Pudlak syndrome 4Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, G2P, Ambry Genetics
- Hermansky-Pudlak syndrome with pulmonary fibrosisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001013694.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SRRD | NM_001013694.3 | MANE Select | c.129_149dupGAGAGAGGCGGCGCCCCGGGG | p.Gly50_Pro51insArgGluAlaAlaProArgGly | disruptive_inframe_insertion | Exon 1 of 7 | NP_001013716.2 | Q9UH36 | |
| HPS4 | NM_022081.6 | MANE Select | c.-806_-786dupTCTCCCCCGGGGCGCCGCCTC | upstream_gene | N/A | NP_071364.4 | |||
| HPS4 | NM_001349900.2 | c.-806_-786dupTCTCCCCCGGGGCGCCGCCTC | upstream_gene | N/A | NP_001336829.1 | F1LLU8 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SRRD | ENST00000215917.11 | TSL:1 MANE Select | c.129_149dupGAGAGAGGCGGCGCCCCGGGG | p.Gly50_Pro51insArgGluAlaAlaProArgGly | disruptive_inframe_insertion | Exon 1 of 7 | ENSP00000215917.6 | Q9UH36 | |
| SRRD | ENST00000942937.1 | c.129_149dupGAGAGAGGCGGCGCCCCGGGG | p.Gly50_Pro51insArgGluAlaAlaProArgGly | disruptive_inframe_insertion | Exon 1 of 8 | ENSP00000612996.1 | |||
| SRRD | ENST00000885114.1 | c.129_149dupGAGAGAGGCGGCGCCCCGGGG | p.Gly50_Pro51insArgGluAlaAlaProArgGly | disruptive_inframe_insertion | Exon 1 of 7 | ENSP00000555173.1 |
Frequencies
GnomAD3 genomes AF: 0.000551 AC: 80AN: 145272Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000673 AC: 80AN: 1188326Hom.: 0 Cov.: 0 AF XY: 0.0000676 AC XY: 39AN XY: 577030 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000550 AC: 80AN: 145378Hom.: 0 Cov.: 0 AF XY: 0.000524 AC XY: 37AN XY: 70612 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at