rs66831137

chr22-26483980-GGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGGGAGA-Gchr22-26483980-GGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGGGAGA-GGAGGCGGCGCCCCGGGGGAGAchr22-26483980-GGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGGGAGA-GGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGGGAGA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_001013694.3(SRRD):c.108_149del(p.Arg37_Gly50del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000697 in 1,333,678 control chromosomes in the GnomAD database, including 4 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00045 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00073 (4 hom.)
• Consequence: SRRD NM_001013694.3 inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.735

Genes affected

SRRD (HGNC:33910): (SRR1 domain containing) Predicted to be involved in microtubule-based process; regulation of circadian rhythm; and regulation of heme biosynthetic process. Predicted to be active in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Apr 2022]

HPS4 (HGNC:15844): (HPS4 biogenesis of lysosomal organelles complex 3 subunit 2) This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001013694.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
SRRD	NM_001013694.3	c.108_149del	p.Arg37_Gly50del	inframe_deletion	1/7	ENST00000215917.11
SRRD	XM_017028799.3	c.108_149del	p.Arg37_Gly50del	inframe_deletion	1/6
SRRD	XM_011530178.3	c.-152_-111del		5_prime_UTR_variant	1/7

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
SRRD	ENST00000215917.11	c.108_149del	p.Arg37_Gly50del	inframe_deletion	1/7	1	NM_001013694.3	P1
HPS4	ENST00000699250.1			upstream_gene_variant				A2

Frequencies

GnomAD3 genomes AF: 0.000447 AC: 65 AN: 145270 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000278

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000471

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000717

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.00228 AC: 22 AN: 9648 Hom.: 0 AF XY: 0.00204 AC XY: 12 AN XY: 5884

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000727

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00452

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00306

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000728 AC: 865 AN: 1188302 Hom.: 4 AF XY: 0.000726 AC XY: 419 AN XY: 577024

Gnomad4 AFR exome AF: 0.000302

Gnomad4 AMR exome AF: 0.000682

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000187

Gnomad4 SAS exome AF: 0.00117

Gnomad4 FIN exome AF: 0.000106

Gnomad4 NFE exome AF: 0.000766

Gnomad4 OTH exome AF: 0.000557

GnomAD4 genome AF: 0.000447 AC: 65 AN: 145376 Hom.: 0 Cov.: 0 AF XY: 0.000297 AC XY: 21 AN XY: 70610

Gnomad4 AFR AF: 0.000277

Gnomad4 AMR AF: 0.000470

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000717

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs66831137; hg19: chr22-26879946;