22-28695735-TCCAGCAGTCCACAGCACGGTTATAC-TCCAGCAGTCCACAGCACGGTTATACCCAGCAGTCCACAGCACGGTTATAC

Variant names:

• chr22-28695735-T-TCCAGCAGTCCACAGCACGGTTATAC
• rs1555913672
• NM_007194.4:c.1209_1233dupGTATAACCGTGCTGTGGACTGCTGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_007194.4(CHEK2):​c.1209_1233dupGTATAACCGTGCTGTGGACTGCTGG​(p.Ser412ValfsTer2) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CHEK2 NM_007194.4 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 6.85
• Publications: 1 publications found

Genes affected

CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

CHEK2 Gene-Disease associations (from GenCC):

• CHEK2-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
• Li-Fraumeni syndrome 2

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• acute myeloid leukemia

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary nonpolyposis colon cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• familial ovarian cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 22-28695735-T-TCCAGCAGTCCACAGCACGGTTATAC is Pathogenic according to our data. Variant chr22-28695735-T-TCCAGCAGTCCACAGCACGGTTATAC is described in ClinVar as Pathogenic. ClinVar VariationId is 1451414.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007194.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHEK2	NM_007194.4	MANE Select	c.1209_1233dupGTATAACCGTGCTGTGGACTGCTGG	p.Ser412ValfsTer2	frameshift stop_gained	Exon 11 of 15	NP_009125.1
	CHEK2	NM_001005735.3		c.1338_1362dupGTATAACCGTGCTGTGGACTGCTGG	p.Ser455ValfsTer2	frameshift stop_gained	Exon 12 of 16	NP_001005735.1
	CHEK2	NM_001438293.1		c.1302_1326dupGTATAACCGTGCTGTGGACTGCTGG	p.Ser443ValfsTer2	frameshift stop_gained	Exon 12 of 16	NP_001425222.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHEK2	ENST00000404276.6	TSL:1 MANE Select	c.1209_1233dupGTATAACCGTGCTGTGGACTGCTGG	p.Ser412ValfsTer2	frameshift stop_gained	Exon 11 of 15	ENSP00000385747.1
	CHEK2	ENST00000382580.6	TSL:1	c.1338_1362dupGTATAACCGTGCTGTGGACTGCTGG	p.Ser455ValfsTer2	frameshift stop_gained	Exon 12 of 16	ENSP00000372023.2
	CHEK2	ENST00000402731.6	TSL:1	c.1008_1032dupGTATAACCGTGCTGTGGACTGCTGG	p.Ser345ValfsTer2	frameshift stop_gained	Exon 9 of 13	ENSP00000384835.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial cancer of breast Pathogenic:1

Mar 01, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with CHEK2-related conditions. This sequence change creates a premature translational stop signal (p.Ser412Valfs*2) in the CHEK2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CHEK2 are known to be pathogenic (PMID: 21876083, 24713400). This variant is not present in population databases (gnomAD no frequency).

Hereditary cancer-predisposing syndrome Pathogenic:1

Apr 14, 2025

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1209_1233dup25 variant, located in coding exon 10 of the CHEK2 gene, results from a duplication of 25 nucleotides at positions 1209 to 1233, causing a translational frameshift with a predicted alternate stop codon (p.S412Vfs*2). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555913672; hg19: chr22-29091723;