22-28695735-TCCAGCAGTCCACAGCACGGTTATAC-TCCAGCAGTCCACAGCACGGTTATACCCAGCAGTCCACAGCACGGTTATAC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_007194.4(CHEK2):​c.1209_1233dupGTATAACCGTGCTGTGGACTGCTGG​(p.Ser412fs) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

CHEK2
NM_007194.4 frameshift, stop_gained

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 6.85
Variant links:
Genes affected
CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 22-28695735-T-TCCAGCAGTCCACAGCACGGTTATAC is Pathogenic according to our data. Variant chr22-28695735-T-TCCAGCAGTCCACAGCACGGTTATAC is described in ClinVar as [Pathogenic]. Clinvar id is 1451414.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
CHEK2NM_007194.4 linkc.1209_1233dupGTATAACCGTGCTGTGGACTGCTGG p.Ser412fs frameshift_variant, stop_gained 11/15 ENST00000404276.6 NP_009125.1 O96017-1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
CHEK2ENST00000404276.6 linkc.1209_1233dupGTATAACCGTGCTGTGGACTGCTGG p.Ser412fs frameshift_variant, stop_gained 11/151 NM_007194.4 ENSP00000385747.1 O96017-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial cancer of breast Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpMar 01, 2022Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with CHEK2-related conditions. This sequence change creates a premature translational stop signal (p.Ser412Valfs*2) in the CHEK2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CHEK2 are known to be pathogenic (PMID: 21876083, 24713400). This variant is not present in population databases (gnomAD no frequency). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr22-29091723; API