22-36296899-CGCGATCTGGGCCTGGAGCTCG-C
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 3P and 1B. PP3PP5_ModerateBP3
The NM_002473.6(MYH9):c.3195_3215delCGAGCTCCAGGCCCAGATCGC(p.Glu1066_Ala1072del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A1065A) has been classified as Likely benign.
Frequency
Consequence
NM_002473.6 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant nonsyndromic hearing loss 17Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing lossInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), G2P, Orphanet
- May-Hegglin anomalyInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- autosomal dominant nonsyndromic hearing lossInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002473.6. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYH9 | TSL:1 MANE Select | c.3195_3215delCGAGCTCCAGGCCCAGATCGC | p.Glu1066_Ala1072del | disruptive_inframe_deletion | Exon 25 of 41 | ENSP00000216181.6 | P35579-1 | ||
| MYH9 | c.3258_3278delCGAGCTCCAGGCCCAGATCGC | p.Glu1087_Ala1093del | disruptive_inframe_deletion | Exon 26 of 42 | ENSP00000510688.1 | A0A8I5KWT8 | |||
| MYH9 | c.3258_3278delCGAGCTCCAGGCCCAGATCGC | p.Glu1087_Ala1093del | disruptive_inframe_deletion | Exon 26 of 42 | ENSP00000625627.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.