rs876661302

Variant names:

• chr22-36296899-CGCGATCTGGGCCTGGAGCTCG-C
• rs876661302
• NM_002473.6:c.3195_3215delCGAGCTCCAGGCCCAGATCGC

Your query was ambiguous. Multiple possible variants found:

• chr22-36296899-CGCGATCTGGGCCTGGAGCTCG-C
• chr22-36296899-CGCGATCTGGGCCTGGAGCTCG-CGCGATCTGGGCCTGGAGCTCGGCGATCTGGGCCTGGAGCTCG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 3P and 1B. PP3 PP5_Moderate BP3

The NM_002473.6(MYH9):​c.3195_3215delCGAGCTCCAGGCCCAGATCGC​(p.Glu1066_Ala1072del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A1065A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYH9 NM_002473.6 disruptive_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 9.97
• Publications: 4 publications found

Genes affected

MYH9 (HGNC:7579): (myosin heavy chain 9) This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]

MYH9 Gene-Disease associations (from GenCC):

• autosomal dominant nonsyndromic hearing loss 17

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• May-Hegglin anomaly

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• autosomal dominant nonsyndromic hearing loss

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 22-36296899-CGCGATCTGGGCCTGGAGCTCG-C is Pathogenic according to our data. Variant chr22-36296899-CGCGATCTGGGCCTGGAGCTCG-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 14084.Status of the report is criteria_provided_single_submitter, 1 stars.
• BP3: Nonframeshift variant in repetitive region in NM_002473.6

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002473.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYH9	NM_002473.6	MANE Select	c.3195_3215delCGAGCTCCAGGCCCAGATCGC	p.Glu1066_Ala1072del	disruptive_inframe_deletion	Exon 25 of 41	NP_002464.1	P35579-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYH9	ENST00000216181.11	TSL:1 MANE Select	c.3195_3215delCGAGCTCCAGGCCCAGATCGC	p.Glu1066_Ala1072del	disruptive_inframe_deletion	Exon 25 of 41	ENSP00000216181.6	P35579-1
	MYH9	ENST00000685801.1		c.3258_3278delCGAGCTCCAGGCCCAGATCGC	p.Glu1087_Ala1093del	disruptive_inframe_deletion	Exon 26 of 42	ENSP00000510688.1	A0A8I5KWT8
	MYH9	ENST00000955568.1		c.3258_3278delCGAGCTCCAGGCCCAGATCGC	p.Glu1087_Ala1093del	disruptive_inframe_deletion	Exon 26 of 42	ENSP00000625627.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
2	-	-	Macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=17/183	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs876661302; hg19: chr22-36692945;