22-37983510-A-ACGGGCATGGGCACCAGCGTC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_006941.4(SOX10):​c.255_274dupGACGCTGGTGCCCATGCCCG​(p.Val92GlyfsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

SOX10
NM_006941.4 frameshift

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 7.50

Publications

0 publications found
Variant links:
Genes affected
SOX10 (HGNC:11190): (SRY-box transcription factor 10) This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein acts as a nucleocytoplasmic shuttle protein and is important for neural crest and peripheral nervous system development. Mutations in this gene are associated with Waardenburg-Shah and Waardenburg-Hirschsprung disease. [provided by RefSeq, Jul 2008]
POLR2F (HGNC:9193): (RNA polymerase II, I and III subunit F) This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 22-37983510-A-ACGGGCATGGGCACCAGCGTC is Pathogenic according to our data. Variant chr22-37983510-A-ACGGGCATGGGCACCAGCGTC is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 547775.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SOX10NM_006941.4 linkc.255_274dupGACGCTGGTGCCCATGCCCG p.Val92GlyfsTer24 frameshift_variant Exon 2 of 4 ENST00000396884.8 NP_008872.1 P56693-1A0A024R1N6
POLR2FNM_001301130.2 linkc.294-2642_294-2623dupGGGCATGGGCACCAGCGTCC intron_variant Intron 4 of 5 NP_001288059.1 B0QYL9
POLR2FNM_001363825.1 linkc.*38+11202_*38+11221dupGGGCATGGGCACCAGCGTCC intron_variant Intron 5 of 5 NP_001350754.1
POLR2FNM_001301131.2 linkc.293+16342_293+16361dupGGGCATGGGCACCAGCGTCC intron_variant Intron 4 of 4 NP_001288060.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SOX10ENST00000396884.8 linkc.255_274dupGACGCTGGTGCCCATGCCCG p.Val92GlyfsTer24 frameshift_variant Exon 2 of 4 1 NM_006941.4 ENSP00000380093.2 P56693-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Waardenburg syndrome type 4C Pathogenic:1
Nov 01, 2016
Center for Human Genetics, Inc, Center for Human Genetics, Inc
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
7.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555939476; hg19: chr22-38379517; API