22-45795354-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT-GATTCTATTCT
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1BS2
The NM_013236.4(ATXN10):c.1174-11569_1174-11535delATTCTATTCTATTCTATTCTATTCTATTCTATTCT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_013236.4 intron
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia type 10Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_013236.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATXN10 | TSL:1 MANE Select | c.1174-11604_1174-11570delATTCTATTCTATTCTATTCTATTCTATTCTATTCT | intron | N/A | ENSP00000252934.4 | Q9UBB4-1 | |||
| ATXN10 | TSL:2 | c.982-11604_982-11570delATTCTATTCTATTCTATTCTATTCTATTCTATTCT | intron | N/A | ENSP00000370449.4 | Q9UBB4-2 | |||
| ATXN10 | TSL:3 | c.430-11604_430-11570delATTCTATTCTATTCTATTCTATTCTATTCTATTCT | intron | N/A | ENSP00000391117.1 | B1AHE4 |
Frequencies
GnomAD3 genomes AF: 0.00497 AC: 629AN: 126534Hom.: 8 Cov.: 0 show subpopulations
GnomAD4 genome AF: 0.00497 AC: 629AN: 126640Hom.: 8 Cov.: 0 AF XY: 0.00488 AC XY: 297AN XY: 60836 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at