22-45795354-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT-GATTCTATTCT

Position:

• chr22-45795354-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT-GATTCTATTCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_013236.4(ATXN10):​c.1174-11569_1174-11535delATTCTATTCTATTCTATTCTATTCTATTCTATTCT variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.0050 (8 hom., cov: 0)
• Consequence: ATXN10 NM_013236.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.237

Genes affected

ATXN10 (HGNC:10549): (ataxin 10) This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00497 (629/126640) while in subpopulation AFR AF= 0.0181 (602/33332). AF 95% confidence interval is 0.0169. There are 8 homozygotes in gnomad4. There are 297 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 629 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN10	NM_013236.4	c.1174-11569_1174-11535delATTCTATTCTATTCTATTCTATTCTATTCTATTCT		intron_variant		ENST00000252934.10	NP_037368.1
ATXN10	NM_001167621.2	c.982-11569_982-11535delATTCTATTCTATTCTATTCTATTCTATTCTATTCT		intron_variant			NP_001161093.1
ATXN10	XM_047441314.1	c.1174-11569_1174-11535delATTCTATTCTATTCTATTCTATTCTATTCTATTCT		intron_variant			XP_047297270.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATXN10	ENST00000252934.10	c.1174-11604_1174-11570delATTCTATTCTATTCTATTCTATTCTATTCTATTCT		intron_variant		1	NM_013236.4	ENSP00000252934.4

Frequencies

GnomAD3 genomes AF: 0.00497 AC: 629 AN: 126534 Hom.: 8 Cov.: 0

Gnomad AFR AF: 0.0181

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00154

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000276

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000336

Gnomad OTH AF: 0.00294

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00497 AC: 629 AN: 126640 Hom.: 8 Cov.: 0 AF XY: 0.00488 AC XY: 297 AN XY: 60836

Gnomad4 AFR AF: 0.0181

Gnomad4 AMR AF: 0.00154

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000275

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000336

Gnomad4 OTH AF: 0.00292

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs60726084; hg19: chr22-46191234;