22-45795354-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT

Variant names:

• chr22-45795354-G-GATTCTATTCTATTCT
• rs60726084
• NM_013236.4:c.1174-11549_1174-11535dupATTCTATTCTATTCT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_013236.4(ATXN10):​c.1174-11549_1174-11535dupATTCTATTCTATTCT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.0077 (20 hom., cov: 0)
• Consequence: ATXN10 NM_013236.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.237
• Publications: 1 publications found

Genes affected

ATXN10 (HGNC:10549): (ataxin 10) This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]

ATXN10 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 10

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.00768 (973/126632) while in subpopulation EAS AF = 0.0462 (186/4028). AF 95% confidence interval is 0.0408. There are 20 homozygotes in GnomAd4. There are 461 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High AC in GnomAd4 at 973 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN10	NM_013236.4	c.1174-11549_1174-11535dupATTCTATTCTATTCT		intron_variant	Intron 9 of 11	ENST00000252934.10	NP_037368.1
ATXN10	NM_001167621.2	c.982-11549_982-11535dupATTCTATTCTATTCT		intron_variant	Intron 8 of 10		NP_001161093.1
ATXN10	XM_047441314.1	c.1174-11549_1174-11535dupATTCTATTCTATTCT		intron_variant	Intron 9 of 11		XP_047297270.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN10	ENST00000252934.10	c.1174-11605_1174-11604insATTCTATTCTATTCT		intron_variant	Intron 9 of 11	1	NM_013236.4	ENSP00000252934.4

Frequencies

GnomAD3 genomes AF: 0.00766 AC: 969 AN: 126526 Hom.: 20 Cov.: 0

Gnomad AFR AF: 0.00608

Gnomad AMI AF: 0.00735

Gnomad AMR AF: 0.00770

Gnomad ASJ AF: 0.00553

Gnomad EAS AF: 0.0464

Gnomad SAS AF: 0.00910

Gnomad FIN AF: 0.00252

Gnomad MID AF: 0.00345

Gnomad NFE AF: 0.00661

Gnomad OTH AF: 0.00882

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00768 AC: 973 AN: 126632 Hom.: 20 Cov.: 0 AF XY: 0.00758 AC XY: 461 AN XY: 60834

African (AFR) AF: 0.00615 AC: 205 AN: 33334

American (AMR) AF: 0.00769 AC: 95 AN: 12348

Ashkenazi Jewish (ASJ) AF: 0.00553 AC: 17 AN: 3076

East Asian (EAS) AF: 0.0462 AC: 186 AN: 4028

South Asian (SAS) AF: 0.00909 AC: 33 AN: 3630

European-Finnish (FIN) AF: 0.00252 AC: 20 AN: 7936

Middle Eastern (MID) AF: 0.00368 AC: 1 AN: 272

European-Non Finnish (NFE) AF: 0.00661 AC: 393 AN: 59478

Other (OTH) AF: 0.00992 AC: 17 AN: 1714

Alfa AF: 0.00429 Hom.: 99

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.24
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60726084; hg19: chr22-46191234;