3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G

Variant names:

• chr3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G
• rs746312225
• NM_014049.5:c.15_40delGCTCTTCCTGCGCACCACGGCTGCGG

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1_Strong PM2 PP5_Very_Strong

The NM_014049.5(ACAD9):​c.15_40delGCTCTTCCTGCGCACCACGGCTGCGG​(p.Leu6SerfsTer46) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G5G) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ACAD9 NM_014049.5 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 0.823

Genes affected

ACAD9 (HGNC:21497): (acyl-CoA dehydrogenase family member 9) This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]

ACAD9-DT (HGNC:56086): (ACAD9 divergent transcript)

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 14 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G is Pathogenic according to our data. Variant chr3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 850643.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ACAD9	NM_014049.5	c.15_40delGCTCTTCCTGCGCACCACGGCTGCGG	p.Leu6SerfsTer46	frameshift_variant	Exon 1 of 18	ENST00000308982.12	NP_054768.2
ACAD9	NM_001410805.1	c.-261_-236delGCTCTTCCTGCGCACCACGGCTGCGG		5_prime_UTR_variant	Exon 1 of 17		NP_001397734.1
ACAD9	NR_033426.2	n.87_112delGCTCTTCCTGCGCACCACGGCTGCGG		non_coding_transcript_exon_variant	Exon 1 of 18
ACAD9	XR_427367.4	n.87_112delGCTCTTCCTGCGCACCACGGCTGCGG		non_coding_transcript_exon_variant	Exon 1 of 11

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ACAD9	ENST00000308982.12	c.15_40delGCTCTTCCTGCGCACCACGGCTGCGG	p.Leu6SerfsTer46	frameshift_variant	Exon 1 of 18	1	NM_014049.5	ENSP00000312618.7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

Aug 30, 2023

GeneDx

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge; This variant is associated with the following publications: (PMID: 25721401, 27535533) -

Nov 01, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has not been reported in the literature in individuals affected with ACAD9-related conditions. For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 850643). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu6Serfs*46) in the ACAD9 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ACAD9 are known to be pathogenic (PMID: 25721401). -

Acyl-CoA dehydrogenase 9 deficiency Pathogenic:1

Oct 30, 2021

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs746312225; hg19: chr3-128598539;