chr3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G
Variant summary
Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1_StrongPM2PP5_Very_Strong
The NM_014049.5(ACAD9):c.15_40delGCTCTTCCTGCGCACCACGGCTGCGG(p.Leu6fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G5G) has been classified as Likely benign.
Frequency
Genomes: not found (cov: 32)
Consequence
ACAD9
NM_014049.5 frameshift
NM_014049.5 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.823
Genes affected
ACAD9 (HGNC:21497): (acyl-CoA dehydrogenase family member 9) This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 14 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 14 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G is Pathogenic according to our data. Variant chr3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 850643.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ACAD9 | NM_014049.5 | c.15_40delGCTCTTCCTGCGCACCACGGCTGCGG | p.Leu6fs | frameshift_variant | 1/18 | ENST00000308982.12 | NP_054768.2 | |
ACAD9 | NM_001410805.1 | c.-261_-236delGCTCTTCCTGCGCACCACGGCTGCGG | 5_prime_UTR_variant | 1/17 | NP_001397734.1 | |||
ACAD9 | NR_033426.2 | n.87_112delGCTCTTCCTGCGCACCACGGCTGCGG | non_coding_transcript_exon_variant | 1/18 | ||||
ACAD9 | XR_427367.4 | n.87_112delGCTCTTCCTGCGCACCACGGCTGCGG | non_coding_transcript_exon_variant | 1/11 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
not provided Pathogenic:2
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Nov 01, 2022 | For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 850643). This variant has not been reported in the literature in individuals affected with ACAD9-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu6Serfs*46) in the ACAD9 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ACAD9 are known to be pathogenic (PMID: 25721401). - |
Likely pathogenic, criteria provided, single submitter | clinical testing | GeneDx | Aug 30, 2023 | Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge; This variant is associated with the following publications: (PMID: 25721401, 27535533) - |
Acyl-CoA dehydrogenase 9 deficiency Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Fulgent Genetics, Fulgent Genetics | Oct 30, 2021 | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at