chr3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G

Position:

• chr3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1_Strong PM2 PP5_Very_Strong

The NM_014049.5(ACAD9):​c.15_40delGCTCTTCCTGCGCACCACGGCTGCGG​(p.Leu6fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G5G) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ACAD9 NM_014049.5 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 0.823

Genes affected

ACAD9 (HGNC:21497): (acyl-CoA dehydrogenase family member 9) This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 14 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G is Pathogenic according to our data. Variant chr3-128879696-GCGGCTGCGGGCTCTTCCTGCGCACCA-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 850643.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ACAD9	NM_014049.5	c.15_40delGCTCTTCCTGCGCACCACGGCTGCGG	p.Leu6fs	frameshift_variant	1/18	ENST00000308982.12	NP_054768.2
ACAD9	NM_001410805.1	c.-261_-236delGCTCTTCCTGCGCACCACGGCTGCGG		5_prime_UTR_variant	1/17		NP_001397734.1
ACAD9	NR_033426.2	n.87_112delGCTCTTCCTGCGCACCACGGCTGCGG		non_coding_transcript_exon_variant	1/18
ACAD9	XR_427367.4	n.87_112delGCTCTTCCTGCGCACCACGGCTGCGG		non_coding_transcript_exon_variant	1/11

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ACAD9	ENST00000308982.12	c.15_40delGCTCTTCCTGCGCACCACGGCTGCGG	p.Leu6fs	frameshift_variant	1/18	1	NM_014049.5	ENSP00000312618.7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Nov 01, 2022	For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 850643). This variant has not been reported in the literature in individuals affected with ACAD9-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu6Serfs*46) in the ACAD9 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ACAD9 are known to be pathogenic (PMID: 25721401). -
Likely pathogenic, criteria provided, single submitter	clinical testing	GeneDx	Aug 30, 2023	Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge; This variant is associated with the following publications: (PMID: 25721401, 27535533) -

Acyl-CoA dehydrogenase 9 deficiency Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Fulgent Genetics, Fulgent Genetics

Oct 30, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs746312225; hg19: chr3-128598539;