3-136250362-CCGGCACAGCAAAAATGGCGG-C

Variant names:

• chr3-136250362-CCGGCACAGCAAAAATGGCGG-C
• NM_000532.5:c.-8_12delCAGCAAAAATGGCGGCGGCA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PP5_Moderate

The ENST00000478469(PCCB):​c.-8_12delCAGCAAAAATGGCGGCGGCA variant causes a 5 prime UTR truncation, exon loss change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000147 in 1,357,372 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000015 (0 hom.)
• Consequence: PCCB ENST00000478469 5_prime_UTR_truncation, exon_loss
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.391

Genes affected

PCCB (HGNC:8654): (propionyl-CoA carboxylase subunit beta) The protein encoded by this gene is a subunit of the propionyl-CoA carboxylase (PCC) enzyme, which is involved in the catabolism of propionyl-CoA. PCC is a mitochondrial enzyme that probably acts as a dodecamer of six alpha subunits and six beta subunits. This gene encodes the beta subunit of PCC. Defects in this gene are a cause of propionic acidemia type II (PA-2). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-136250362-CCGGCACAGCAAAAATGGCGG-C is Pathogenic according to our data. Variant chr3-136250362-CCGGCACAGCAAAAATGGCGG-C is described in ClinVar as [Pathogenic]. Clinvar id is 1069994.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PCCB	NM_000532.5	c.-8_12delCAGCAAAAATGGCGGCGGCA	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 15	ENST00000251654.9	NP_000523.2
PCCB	NM_000532.5	c.-8_12delCAGCAAAAATGGCGGCGGCA		5_prime_UTR_variant	Exon 1 of 15	ENST00000251654.9	NP_000523.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PCCB	ENST00000251654.9	c.-8_12delCAGCAAAAATGGCGGCGGCA	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 15	1	NM_000532.5	ENSP00000251654.4
PCCB	ENST00000251654	c.-8_12delCAGCAAAAATGGCGGCGGCA		5_prime_UTR_variant	Exon 1 of 15	1	NM_000532.5	ENSP00000251654.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000147 AC: 2 AN: 1357372 Hom.: 0 AF XY: 0.00000301 AC XY: 2 AN XY: 663802

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000189

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Propionic acidemia Pathogenic:1

Nov 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the PCCB mRNA. The next in-frame methionine is located at codon 84. This variant is not present in population databases (gnomAD no frequency). Disruption of the initiator codon has been observed in individual(s) with propionic acidemia (internal data). ClinVar contains an entry for this variant (Variation ID: 1069994). This variant disrupts the p.Arg44 amino acid residue in PCCB. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 9683601, 12007220, 12757933). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-135969204;