3-138946021-CGCGGCTGCAGCCGCAGCTGCTGCAGCCGCT-CGCGGCTGCAGCCGCAGCTGCTGCAGCCGCTGCGGCTGCAGCCGCAGCTGCTGCAGCCGCT

Variant names:

• chr3-138946021-C-CGCGGCTGCAGCCGCAGCTGCTGCAGCCGCT
• rs387906321
• NM_023067.4:c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 8P and 1B. PP5_Very_Strong BP3

The NM_023067.4(FOXL2):​c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC​(p.Ala225_Ala234dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000323 in 1,239,458 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000032 (0 hom.)
• Consequence: FOXL2 NM_023067.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 3.29
• Publications: 15 publications found

Genes affected

FOXL2 (HGNC:1092): (forkhead box L2) This gene encodes a forkhead transcription factor. The protein contains a fork-head DNA-binding domain and may play a role in ovarian development and function. Expansion of a polyalanine repeat region and other mutations in this gene are a cause of blepharophimosis syndrome and premature ovarian failure 3. [provided by RefSeq, Jul 2016]

FOXL2 Gene-Disease associations (from GenCC):

• blepharophimosis, ptosis, and epicanthus inversus syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• premature ovarian failure 3

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

• PP5: Variant 3-138946021-C-CGCGGCTGCAGCCGCAGCTGCTGCAGCCGCT is Pathogenic according to our data. Variant chr3-138946021-C-CGCGGCTGCAGCCGCAGCTGCTGCAGCCGCT is described in ClinVar as Pathogenic. ClinVar VariationId is 4854.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BP3: Nonframeshift variant in repetitive region in NM_023067.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_023067.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXL2	NM_023067.4	MANE Select	c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC	p.Ala225_Ala234dup	disruptive_inframe_insertion	Exon 1 of 1	NP_075555.1	Q53ZD3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXL2	ENST00000648323.1	MANE Select	c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC	p.Ala225_Ala234dup	disruptive_inframe_insertion	Exon 1 of 1	ENSP00000497217.1	P58012

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000323 AC: 4 AN: 1239458 Hom.: 0 Cov.: 31 AF XY: 0.00000658 AC XY: 4 AN XY: 607568

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 23840

American (AMR) AF: 0.00 AC: 0 AN: 10426

Ashkenazi Jewish (ASJ) AF: 0.0000548 AC: 1 AN: 18232

East Asian (EAS) AF: 0.00 AC: 0 AN: 28066

South Asian (SAS) AF: 0.0000176 AC: 1 AN: 56886

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 30004

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3532

European-Non Finnish (NFE) AF: 0.00000197 AC: 2 AN: 1017506

Other (OTH) AF: 0.00 AC: 0 AN: 50966

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0339446), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
4	-	-	Blepharophimosis, ptosis, and epicanthus inversus syndrome (4)
2	-	-	not provided (2)
1	-	-	BLEPHAROPHIMOSIS, PTOSIS, AND EPICANTHUS INVERSUS, TYPE II (1)
1	-	-	Blepharophimosis, ptosis, and epicanthus inversus, type II with Duane retraction syndrome (1)
1	-	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.3
Mutation Taster		=83/17	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs387906321; hg19: chr3-138664863;