NM_023067.4:c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC
Variant summary
Our verdict is Pathogenic. The variant received 11 ACMG points: 12P and 1B. PS3PP5_Very_StrongBP3
The NM_023067.4(FOXL2):c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.Ala225_Ala234dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000323 in 1,239,458 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV005908641: Published functional studies demonstrate a damaging effect (increased expression in the cytoplasm and induced cytoplasmic and nuclear aggregation) (PMID:15591279)".
Frequency
Consequence
NM_023067.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- blepharophimosis, ptosis, and epicanthus inversus syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
- premature ovarian failure 3Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 11 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_023067.4. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 0.00000323 AC: 4AN: 1239458Hom.: 0 Cov.: 31 AF XY: 0.00000658 AC XY: 4AN XY: 607568 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at