3-181712336-GGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCC-G

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_StrongPM2PP5

The NM_003106.4(SOX2):​c.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 32)

Consequence

SOX2
NM_003106.4 frameshift, start_lost

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 3.26
Variant links:
Genes affected
SOX2 (HGNC:11195): (SRY-box transcription factor 2) This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT). [provided by RefSeq, Jul 2008]
SOX2-OT (HGNC:20209): (SOX2 overlapping transcript) This gene produces alternatively spliced long non-coding RNAs. These RNAs were observed to be upregulated in tumor cells and positively correlated to expression of the SRY-box 2 gene. Overexpression of these transcripts may promote cell proliferation. [provided by RefSeq, Dec 2017]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 4 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 3-181712336-GGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCC-G is Pathogenic according to our data. Variant chr3-181712336-GGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 986769.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
SOX2NM_003106.4 linkc.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC p.Met1fs frameshift_variant, start_lost 1/1 ENST00000325404.3 NP_003097.1 P48431A0A0U3FYV6
SOX2NM_003106.4 linkc.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC 5_prime_UTR_variant 1/1 ENST00000325404.3 NP_003097.1 P48431A0A0U3FYV6

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
SOX2ENST00000325404.3 linkc.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC p.Met1fs frameshift_variant, start_lost 1/16 NM_003106.4 ENSP00000323588.1 P48431
SOX2ENST00000325404 linkc.-13_43delGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGC 5_prime_UTR_variant 1/1 NM_003106.4 ENSP00000323588.1 P48431

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Anophthalmia/microphthalmia-esophageal atresia syndrome Pathogenic:1
Pathogenic, no assertion criteria providedclinical testingAnophthalmia/Microphthalmia Research Registry, Einstein Medical Center Philadelphia-Patient has symptoms similar to SOX2 related disease and is suspected to be pathogenic -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1714831656; hg19: chr3-181430124; API