3-183015397-GAGAGAAGACACTACTTAACTGGCCAT-G

Variant names:

• chr3-183015397-GAGAGAAGACACTACTTAACTGGCCAT-G
• rs752394015
• ENST00000497830.5:n.*1790_*1815delATGGCCAGTTAAGTAGTGTCTTCTCT

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_Moderate BS1

The NM_020166.5(MCCC1):​c.*15_*40delATGGCCAGTTAAGTAGTGTCTTCTCT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000602 in 1,612,334 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.00030 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000036 (0 hom.)
• Consequence: MCCC1 NM_020166.5 3_prime_UTR
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.15
• Publications: 0 publications found

Genes affected

MCCC1 (HGNC:6936): (methylcrotonyl-CoA carboxylase subunit 1) This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]

MCCC1 Gene-Disease associations (from GenCC):

• 3-methylcrotonyl-CoA carboxylase 1 deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• 3-methylcrotonyl-CoA carboxylase deficiency

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• BP6: Variant 3-183015397-GAGAGAAGACACTACTTAACTGGCCAT-G is Benign according to our data. Variant chr3-183015397-GAGAGAAGACACTACTTAACTGGCCAT-G is described in ClinVar as [Likely_benign]. Clinvar id is 420442.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.000295 (45/152310) while in subpopulation AFR AF = 0.00101 (42/41564). AF 95% confidence interval is 0.000768. There are 0 homozygotes in GnomAd4. There are 28 alleles in the male GnomAd4 subpopulation. Median coverage is 32. This position passed quality control check.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MCCC1	NM_020166.5	c.*15_*40delATGGCCAGTTAAGTAGTGTCTTCTCT		3_prime_UTR_variant	Exon 19 of 19	ENST00000265594.9	NP_064551.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MCCC1	ENST00000265594.9	c.*15_*40delATGGCCAGTTAAGTAGTGTCTTCTCT		3_prime_UTR_variant	Exon 19 of 19	1	NM_020166.5	ENSP00000265594.4

Frequencies

GnomAD3 genomes AF: 0.000296 AC: 45 AN: 152192 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00101

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000676 AC: 17 AN: 251358 AF XY: 0.0000294

Gnomad AFR exome AF: 0.000615

Gnomad AMR exome AF: 0.000173

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000880

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000356 AC: 52 AN: 1460024 Hom.: 0 AF XY: 0.0000262 AC XY: 19 AN XY: 726452

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000448 AC: 15 AN: 33454

American (AMR) AF: 0.000157 AC: 7 AN: 44718

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26124

East Asian (EAS) AF: 0.00 AC: 0 AN: 39672

South Asian (SAS) AF: 0.00 AC: 0 AN: 86168

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53370

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5746

European-Non Finnish (NFE) AF: 0.0000234 AC: 26 AN: 1110462

Other (OTH) AF: 0.0000663 AC: 4 AN: 60310

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000295 AC: 45 AN: 152310 Hom.: 0 Cov.: 32 AF XY: 0.000376 AC XY: 28 AN XY: 74472

African (AFR) AF: 0.00101 AC: 42 AN: 41564

American (AMR) AF: 0.0000654 AC: 1 AN: 15296

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5178

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10620

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000294 AC: 2 AN: 68036

Other (OTH) AF: 0.00 AC: 0 AN: 2112

Alfa AF: 0.000144 Hom.: 0

Bravo AF: 0.000336

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Mar 17, 2016

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs752394015; hg19: chr3-182733185;