3-183015397-GAGAGAAGACACTACTTAACTGGCCAT-G

Position:

• chr3-183015397-GAGAGAAGACACTACTTAACTGGCCAT-G

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 2P and 6B. PM2 BP6_Moderate BS1

The NM_020166.5(MCCC1):​c.*15_*40delATGGCCAGTTAAGTAGTGTCTTCTCT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000602 in 1,612,334 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.00030 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000036 (0 hom.)
• Consequence: MCCC1 NM_020166.5 3_prime_UTR
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.15

Genes affected

MCCC1 (HGNC:6936): (methylcrotonyl-CoA carboxylase subunit 1) This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]

MCCC1 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 3-183015397-GAGAGAAGACACTACTTAACTGGCCAT-G is Benign according to our data. Variant chr3-183015397-GAGAGAAGACACTACTTAACTGGCCAT-G is described in ClinVar as [Likely_benign]. Clinvar id is 420442.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.000295 (45/152310) while in subpopulation AFR AF= 0.00101 (42/41564). AF 95% confidence interval is 0.000768. There are 0 homozygotes in gnomad4. There are 28 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MCCC1	NM_020166.5	c.*15_*40delATGGCCAGTTAAGTAGTGTCTTCTCT		3_prime_UTR_variant	19/19	ENST00000265594.9	NP_064551.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MCCC1	ENST00000265594	c.*15_*40delATGGCCAGTTAAGTAGTGTCTTCTCT		3_prime_UTR_variant	19/19	1	NM_020166.5	ENSP00000265594.4

Frequencies

GnomAD3 genomes AF: 0.000296 AC: 45 AN: 152192 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00101

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000356 AC: 52 AN: 1460024 Hom.: 0 AF XY: 0.0000262 AC XY: 19 AN XY: 726452

Gnomad4 AFR exome AF: 0.000448

Gnomad4 AMR exome AF: 0.000157

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000234

Gnomad4 OTH exome AF: 0.0000663

GnomAD4 genome AF: 0.000295 AC: 45 AN: 152310 Hom.: 0 Cov.: 32 AF XY: 0.000376 AC XY: 28 AN XY: 74472

Gnomad4 AFR AF: 0.00101

Gnomad4 AMR AF: 0.0000654

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000294

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000144 Hom.: 0

Bravo AF: 0.000336

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Likely benign, criteria provided, single submitter

clinical testing

GeneDx

Mar 17, 2016

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs752394015; hg19: chr3-182733185;