rs752394015
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS1
The ENST00000497830.5(MCCC1):n.*1790_*1815delATGGCCAGTTAAGTAGTGTCTTCTCT variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000602 in 1,612,334 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000497830.5 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- 3-methylcrotonyl-CoA carboxylase 1 deficiencyInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- 3-methylcrotonyl-CoA carboxylase deficiencyInheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MCCC1 | NM_020166.5 | c.*15_*40delATGGCCAGTTAAGTAGTGTCTTCTCT | 3_prime_UTR_variant | Exon 19 of 19 | ENST00000265594.9 | NP_064551.3 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000296 AC: 45AN: 152192Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000676 AC: 17AN: 251358 AF XY: 0.0000294 show subpopulations
GnomAD4 exome AF: 0.0000356 AC: 52AN: 1460024Hom.: 0 AF XY: 0.0000262 AC XY: 19AN XY: 726452 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.000295 AC: 45AN: 152310Hom.: 0 Cov.: 32 AF XY: 0.000376 AC XY: 28AN XY: 74472 show subpopulations
ClinVar
Submissions by phenotype
not specified Benign:1
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at