3-185511516-CAGCTCACCTCTCCGGATGGGCA-C

Variant names:

• chr3-185511516-CAGCTCACCTCTCCGGATGGGCA-C
• NM_139248.3:c.1254_1268+7delTGCCCATCCGGAGAGGTGAGCT

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_139248.3(LIPH):​c.1254_1268+7delTGCCCATCCGGAGAGGTGAGCT​(p.Ala419_Arg423del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: LIPH NM_139248.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.16

Genes affected

LIPH (HGNC:18483): (lipase H) This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.12831858 fraction of the gene. Cryptic splice site detected, with MaxEntScore 7.9, offset of 11, new splice context is: aggGTacgg. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LIPH	NM_139248.3	c.1254_1268+7delTGCCCATCCGGAGAGGTGAGCT	p.Ala419_Arg423del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 9 of 10	ENST00000296252.9	NP_640341.1
LIPH	XM_006713529.5	c.1164_1178+7delTGCCCATCCGGAGAGGTGAGCT	p.Ala389_Arg393del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 8 of 9		XP_006713592.1
LIPH	XM_017005852.3	c.1152_1166+7delTGCCCATCCGGAGAGGTGAGCT	p.Ala385_Arg389del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 8 of 9		XP_016861341.1
LIPH	XM_011512530.4	c.1125_1139+7delTGCCCATCCGGAGAGGTGAGCT	p.Ala376_Arg380del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 10 of 11		XP_011510832.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LIPH	ENST00000296252.9	c.1254_1268+7delTGCCCATCCGGAGAGGTGAGCT	p.Ala419_Arg423del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 9 of 10	1	NM_139248.3	ENSP00000296252.4
LIPH	ENST00000424591.6	c.1152_1166+7delTGCCCATCCGGAGAGGTGAGCT	p.Ala385_Arg389del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 8 of 9	1		ENSP00000396384.2
LIPH	ENST00000435679.1	c.184_198+7delTGCCCATCCGGAGAGGTGAGCT	p.Cys62_Glu66del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 4	5		ENSP00000390228.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Oct 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 9 (c.1254_1268+7del) of the LIPH gene. While this variant is not anticipated to result in nonsense mediated decay, it likely alters RNA splicing and results in a disrupted protein product. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with LIPH-related conditions. Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-185229304;