3-186785941-T-TTGGTGGAACAAATGTTCGAAA

Variant names:

• chr3-186785941-T-TTGGTGGAACAAATGTTCGAAA
• NM_001967.4:c.410_430dupGTGGAACAAATGTTCGAAATG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001967.4(EIF4A2):​c.410_430dupGTGGAACAAATGTTCGAAATG​(p.Gly137_Asn143dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: EIF4A2 NM_001967.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.16

Genes affected

EIF4A2 (HGNC:3284): (eukaryotic translation initiation factor 4A2) Enables ATP hydrolysis activity. Involved in negative regulation of RNA-directed 5'-3' RNA polymerase activity. Located in perinuclear region of cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001967.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EIF4A2	NM_001967.4	c.410_430dupGTGGAACAAATGTTCGAAATG	p.Gly137_Asn143dup	disruptive_inframe_insertion	Exon 5 of 11	ENST00000323963.10	NP_001958.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EIF4A2	ENST00000323963.10	c.410_430dupGTGGAACAAATGTTCGAAATG	p.Gly137_Asn143dup	disruptive_inframe_insertion	Exon 5 of 11	1	NM_001967.4	ENSP00000326381.5

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Uncertain:1

Sep 16, 2024

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.410_430dupGTGGAACAAATGTTCGAAATG (p.G137_N143dup) alteration, located in coding exon 5 of the EIF4A2 gene, results from an in-frame duplication of 21 nucleotides at positions c.410 to c.430. This results in the insertion of 7 amino acids between codons 143 and 144. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). This amino acid position is well conserved in available vertebrate species. This alteration is predicted to be deleterious by in silico analysis (Choi, 2012). Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-186503730;