NM_001967.4:c.410_430dupGTGGAACAAATGTTCGAAATG

Variant names:

• chr3-186785941-T-TTGGTGGAACAAATGTTCGAAA
• NM_001967.4:c.410_430dupGTGGAACAAATGTTCGAAATG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001967.4(EIF4A2):​c.410_430dupGTGGAACAAATGTTCGAAATG​(p.Gly137_Asn143dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: EIF4A2 NM_001967.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.16
• Publications: 0 publications found

Genes affected

EIF4A2 (HGNC:3284): (eukaryotic translation initiation factor 4A2) Enables ATP hydrolysis activity. Involved in negative regulation of RNA-directed 5'-3' RNA polymerase activity. Located in perinuclear region of cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]

EIF4A2 Gene-Disease associations (from GenCC):

• neurodevelopmental disorder with hypotonia and speech delay, with or without seizures

  Inheritance: AR, AD Classification: STRONG, MODERATE, LIMITED Submitted by: G2P, Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001967.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001967.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EIF4A2	NM_001967.4	MANE Select	c.410_430dupGTGGAACAAATGTTCGAAATG	p.Gly137_Asn143dup	disruptive_inframe_insertion	Exon 5 of 11	NP_001958.2	Q14240-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EIF4A2	ENST00000323963.10	TSL:1 MANE Select	c.410_430dupGTGGAACAAATGTTCGAAATG	p.Gly137_Asn143dup	disruptive_inframe_insertion	Exon 5 of 11	ENSP00000326381.5	Q14240-1
	EIF4A2	ENST00000440191.6	TSL:1	c.413_433dupGTGGAACAAATGTTCGAAATG	p.Gly138_Asn144dup	disruptive_inframe_insertion	Exon 5 of 11	ENSP00000398370.2	Q14240-2
	EIF4A2	ENST00000426808.5	TSL:1	n.270_290dupGTGGAACAAATGTTCGAAATG		non_coding_transcript_exon	Exon 4 of 10	ENSP00000392686.1	E9PBH4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr3-186503730;