3-186789971-AACAATTCTGAGATAACTGCTGCATC-A

Variant names:

• chr3-186789971-AACAATTCTGAGATAACTGCTGCATC-A
• NM_002916.5:c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PP5_Moderate

The NM_002916.5(RFC4):​c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT​(p.Met356AsnfsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: RFC4 NM_002916.5 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.36

Genes affected

RFC4 (HGNC:9972): (replication factor C subunit 4) The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]

EIF4A2 (HGNC:3284): (eukaryotic translation initiation factor 4A2) Enables ATP hydrolysis activity. Involved in negative regulation of RNA-directed 5'-3' RNA polymerase activity. Located in perinuclear region of cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-186789971-AACAATTCTGAGATAACTGCTGCATC-A is Pathogenic according to our data. Variant chr3-186789971-AACAATTCTGAGATAACTGCTGCATC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3773694.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RFC4	NM_002916.5	c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT	p.Met356AsnfsTer11	frameshift_variant	Exon 11 of 11	ENST00000296273.7	NP_002907.1
RFC4	NM_181573.3	c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT	p.Met356AsnfsTer11	frameshift_variant	Exon 11 of 11		NP_853551.1
EIF4A2	NM_001967.4	c.*703_*727delACAATTCTGAGATAACTGCTGCATC		downstream_gene_variant		ENST00000323963.10	NP_001958.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RFC4	ENST00000296273.7	c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT	p.Met356AsnfsTer11	frameshift_variant	Exon 11 of 11	1	NM_002916.5	ENSP00000296273.2
EIF4A2	ENST00000323963.10	c.*703_*727delACAATTCTGAGATAACTGCTGCATC		downstream_gene_variant		1	NM_001967.4	ENSP00000326381.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Morimoto-Ryu-Malicdan neuromuscular syndrome Pathogenic:1

Mar 04, 2025

Institute of Human Genetics, University of Leipzig Medical Center

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Criteria applied: PVS1_STR,PM2_SUP -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-186507760;