3-186789971-AACAATTCTGAGATAACTGCTGCATC-A

Variant names:

• chr3-186789971-AACAATTCTGAGATAACTGCTGCATC-A
• NM_002916.5:c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_002916.5(RFC4):​c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT​(p.Met356AsnfsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: RFC4 NM_002916.5 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 7.36

Genes affected

RFC4 (HGNC:9972): (replication factor C subunit 4) The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RFC4	NM_002916.5	c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT	p.Met356AsnfsTer11	frameshift_variant	Exon 11 of 11	ENST00000296273.7	NP_002907.1
RFC4	NM_181573.3	c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT	p.Met356AsnfsTer11	frameshift_variant	Exon 11 of 11		NP_853551.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RFC4	ENST00000296273.7	c.1065_1089delGATGCAGCAGTTATCTCAGAATTGT	p.Met356AsnfsTer11	frameshift_variant	Exon 11 of 11	1	NM_002916.5	ENSP00000296273.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-186507760;