3-37025922-GCCAAAAATCAGAGCTTGGAGGG-GATTTT

Variant names:

• chr3-37025923-CCAAAAATCAGAGCTTGGAGGG-ATTTT
• rs587778903
• NM_000249.4:c.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT

Variant summary

Our verdict is Pathogenic. Variant got 22 ACMG points: 22P and 0B. PVS1 PS1 PM2 PP5_Very_Strong

The NM_000249.4(MLH1):​c.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT​(p.Ala442AspfsTer31) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Another nucleotide change resulting in the same amino acid substitution has been previously reported as Pathogenic in Lovd. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: MLH1 NM_000249.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 3.77

Genes affected

MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]

ACMG classification

Verdict is Pathogenic. Variant got 22 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PS1: Transcript NM_000249.4 (MLH1) is affected with MISSENSE_VARIANT having same AA change as one Pathogenic present in Lovd
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-37025923-CCAAAAATCAGAGCTTGGAGGG-ATTTT is Pathogenic according to our data. Variant chr3-37025923-CCAAAAATCAGAGCTTGGAGGG-ATTTT is described in ClinVar as [Pathogenic]. Clinvar id is 433866.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MLH1	NM_000249.4	c.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT	p.Ala442AspfsTer31	frameshift_variant, missense_variant	Exon 12 of 19	ENST00000231790.8	NP_000240.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MLH1	ENST00000231790.8	c.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT	p.Ala442AspfsTer31	frameshift_variant, missense_variant	Exon 12 of 19	1	NM_000249.4	ENSP00000231790.3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:1

Jul 19, 2023

Myriad Genetics, Inc.

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Muir-Torré syndrome;C1333991:Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:1

Dec 10, 2014

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Lynch syndrome Pathogenic:1

Dec 10, 2014

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:1

Jun 29, 2022

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1325_1346del22insATTTT pathogenic mutation, located in coding exon 12 of the MLH1 gene, results from the deletion of 22 nucleotides and insertion of 5 nucleotides causing a translational frameshift with a predicted alternate stop codon (p.A442Dfs*31). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587778903; hg19: chr3-37067414;