3-37025922-GCCAAAAATCAGAGCTTGGAGGG-GATTTT
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000249.4(MLH1):c.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT(p.Ala442AspfsTer31) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000249.4 frameshift, missense
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
- Lynch syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, G2P, Orphanet
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
- Lynch syndrome 1Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MLH1 | NM_000249.4 | c.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT | p.Ala442AspfsTer31 | frameshift_variant, missense_variant | Exon 12 of 19 | ENST00000231790.8 | NP_000240.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MLH1 | ENST00000231790.8 | c.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT | p.Ala442AspfsTer31 | frameshift_variant, missense_variant | Exon 12 of 19 | 1 | NM_000249.4 | ENSP00000231790.3 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:1
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -
Muir-Torré syndrome;C1333991:Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:1
- -
Lynch syndrome Pathogenic:1
- -
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.1325_1346del22insATTTT pathogenic mutation, located in coding exon 12 of the MLH1 gene, results from the deletion of 22 nucleotides and insertion of 5 nucleotides causing a translational frameshift with a predicted alternate stop codon (p.A442Dfs*31). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at