rs587778903

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000249.4(MLH1):​c.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT​(p.Ala442AspfsTer31) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 31)

Consequence

MLH1
NM_000249.4 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:4

Conservation

PhyloP100: 3.77

Publications

3 publications found
Variant links:
Genes affected
MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]
MLH1 Gene-Disease associations (from GenCC):
  • Lynch syndrome
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
  • Lynch syndrome 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
  • Muir-Torre syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, G2P, Orphanet
  • mismatch repair cancer syndrome 1
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
  • Lynch syndrome 1
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • ovarian cancer
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • malignant pancreatic neoplasm
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • rhabdomyosarcoma
    Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
  • prostate cancer
    Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
  • breast cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
  • hereditary breast carcinoma
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 3-37025923-CCAAAAATCAGAGCTTGGAGGG-ATTTT is Pathogenic according to our data. Variant chr3-37025923-CCAAAAATCAGAGCTTGGAGGG-ATTTT is described in ClinVar as Pathogenic. ClinVar VariationId is 433866.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MLH1NM_000249.4 linkc.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT p.Ala442AspfsTer31 frameshift_variant, missense_variant Exon 12 of 19 ENST00000231790.8 NP_000240.1 P40692-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MLH1ENST00000231790.8 linkc.1325_1346delCCAAAAATCAGAGCTTGGAGGGinsATTTT p.Ala442AspfsTer31 frameshift_variant, missense_variant Exon 12 of 19 1 NM_000249.4 ENSP00000231790.3 P40692-1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:1
Jul 19, 2023
Myriad Genetics, Inc.
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Muir-Torré syndrome;C1333991:Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:1
Dec 10, 2014
Department of Pathology and Laboratory Medicine, Sinai Health System
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Lynch syndrome Pathogenic:1
Dec 10, 2014
Department of Pathology and Laboratory Medicine, Sinai Health System
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:1
Jun 29, 2022
Ambry Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.1325_1346del22insATTTT pathogenic mutation, located in coding exon 12 of the MLH1 gene, results from the deletion of 22 nucleotides and insertion of 5 nucleotides causing a translational frameshift with a predicted alternate stop codon (p.A442Dfs*31). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
3.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs587778903; hg19: chr3-37067414; API