4-107931619-ACCCGAGGCCGCCGGCGCCCGGACCATGTCGTC-A

Variant names:

• chr4-107931619-ACCCGAGGCCGCCGGCGCCCGGACCATGTCGTC-A
• rs747068538
• NM_183075.3:c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_183075.3(CYP2U1):​c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000255 in 1,098,042 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.000025 (0 hom.)
• Consequence: CYP2U1 NM_183075.3 frameshift, start_lost
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.43
• Publications: 0 publications found

Genes affected

CYP2U1 (HGNC:20582): (cytochrome P450 family 2 subfamily U member 1) This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a hydroxylase that metabolizes arachidonic acid, docosahexaenoic acid, and other long chain fatty acids. [provided by RefSeq, Jul 2008]

CYP2U1-AS1 (HGNC:54817): (CYP2U1 and SGMS2 antisense RNA 1)

LOC107986298 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 54 pathogenic variants in the truncated region.
• PP5: Variant 4-107931619-ACCCGAGGCCGCCGGCGCCCGGACCATGTCGTC-A is Pathogenic according to our data. Variant chr4-107931619-ACCCGAGGCCGCCGGCGCCCGGACCATGTCGTC-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 445958.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CYP2U1	NM_183075.3	c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 5	ENST00000332884.11	NP_898898.1
CYP2U1	NM_183075.3	c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC		5_prime_UTR_variant	Exon 1 of 5	ENST00000332884.11	NP_898898.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CYP2U1	ENST00000332884.11	c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 5	1	NM_183075.3	ENSP00000333212.6
CYP2U1	ENST00000332884.11	c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC		5_prime_UTR_variant	Exon 1 of 5	1	NM_183075.3	ENSP00000333212.6

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.0000255 AC: 28 AN: 1098042 Hom.: 0 AF XY: 0.0000287 AC XY: 15 AN XY: 521950

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 23088

American (AMR) AF: 0.00 AC: 0 AN: 8558

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 13968

East Asian (EAS) AF: 0.00 AC: 0 AN: 26684

South Asian (SAS) AF: 0.00 AC: 0 AN: 23312

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 22530

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2922

European-Non Finnish (NFE) AF: 0.0000300 AC: 28 AN: 932912

Other (OTH) AF: 0.00 AC: 0 AN: 44068

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

May 24, 2017

Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs747068538; hg19: chr4-108852775;