rs747068538

Positions:

• chr4-107931619-ACCCGAGGCCGCCGGCGCCCGGACCATGTCGTC-A

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_183075.3(CYP2U1):​c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000255 in 1,098,042 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.000025 (0 hom.)
• Consequence: CYP2U1 NM_183075.3 frameshift, start_lost
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.43

Genes affected

CYP2U1 (HGNC:20582): (cytochrome P450 family 2 subfamily U member 1) This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a hydroxylase that metabolizes arachidonic acid, docosahexaenoic acid, and other long chain fatty acids. [provided by RefSeq, Jul 2008]

CYP2U1 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 4 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-107931619-ACCCGAGGCCGCCGGCGCCCGGACCATGTCGTC-A is Pathogenic according to our data. Variant chr4-107931619-ACCCGAGGCCGCCGGCGCCCGGACCATGTCGTC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 445958.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CYP2U1	NM_183075.3	c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC	p.Met1fs	frameshift_variant, start_lost	1/5	ENST00000332884.11	NP_898898.1
CYP2U1	NM_183075.3	c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC		5_prime_UTR_variant	1/5	ENST00000332884.11	NP_898898.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CYP2U1	ENST00000332884.11	c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC	p.Met1fs	frameshift_variant, start_lost	1/5	1	NM_183075.3	ENSP00000333212.6
CYP2U1	ENST00000332884	c.-24_8delCCCGAGGCCGCCGGCGCCCGGACCATGTCGTC		5_prime_UTR_variant	1/5	1	NM_183075.3	ENSP00000333212.6

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.0000255 AC: 28 AN: 1098042 Hom.: 0 AF XY: 0.0000287 AC XY: 15 AN XY: 521950

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000300

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000378

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics

May 24, 2017

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs747068538; hg19: chr4-108852775;