4-110618210-TGCTTTGCTTTCAGTCTCAGGCTG-T

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_StrongPM2PP5_Moderate

The NM_000325.6(PITX2):​c.867_889delCAGCCTGAGACTGAAAGCAAAGC​(p.Ser290AlafsTer48) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 33)

Consequence

PITX2
NM_000325.6 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 10.0
Variant links:
Genes affected
PITX2 (HGNC:9005): (paired like homeodomain 2) This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.111 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 4-110618210-TGCTTTGCTTTCAGTCTCAGGCTG-T is Pathogenic according to our data. Variant chr4-110618210-TGCTTTGCTTTCAGTCTCAGGCTG-T is described in ClinVar as [Pathogenic]. Clinvar id is 1693129.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr4-110618210-TGCTTTGCTTTCAGTCTCAGGCTG-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PITX2NM_000325.6 linkc.867_889delCAGCCTGAGACTGAAAGCAAAGC p.Ser290AlafsTer48 frameshift_variant Exon 3 of 3 ENST00000644743.1 NP_000316.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PITX2ENST00000644743.1 linkc.867_889delCAGCCTGAGACTGAAAGCAAAGC p.Ser290AlafsTer48 frameshift_variant Exon 3 of 3 NM_000325.6 ENSP00000495061.1 Q99697-2

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Axenfeld-Rieger syndrome type 1 Pathogenic:1
Jun 23, 2022
Human Developmental Genetics Laboratory, Medical College of Wisconsin
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-111539366; API