chr4-110618210-TGCTTTGCTTTCAGTCTCAGGCTG-T
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_StrongPP5_Moderate
The NM_000325.6(PITX2):c.867_889delCAGCCTGAGACTGAAAGCAAAGC(p.Ser290AlafsTer48) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_000325.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- anterior segment dysgenesis 4Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- Axenfeld-Rieger syndrome type 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- ring dermoid of corneaInheritance: AD, Unknown Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae)
- aniridiaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- Axenfeld anomalyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Axenfeld-Rieger syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial atrial fibrillationInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Rieger anomalyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Peters anomalyInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000325.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PITX2 | MANE Select | c.867_889delCAGCCTGAGACTGAAAGCAAAGC | p.Ser290AlafsTer48 | frameshift | Exon 3 of 3 | NP_000316.2 | |||
| PITX2 | c.846_868delCAGCCTGAGACTGAAAGCAAAGC | p.Ser283AlafsTer48 | frameshift | Exon 6 of 6 | NP_001191326.1 | Q99697-1 | |||
| PITX2 | c.846_868delCAGCCTGAGACTGAAAGCAAAGC | p.Ser283AlafsTer48 | frameshift | Exon 5 of 5 | NP_001191327.1 | Q99697-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PITX2 | MANE Select | c.867_889delCAGCCTGAGACTGAAAGCAAAGC | p.Ser290AlafsTer48 | frameshift | Exon 3 of 3 | ENSP00000495061.1 | Q99697-2 | ||
| PITX2 | TSL:1 | c.708_730delCAGCCTGAGACTGAAAGCAAAGC | p.Ser237AlafsTer48 | frameshift | Exon 4 of 4 | ENSP00000347192.5 | Q99697-3 | ||
| PITX2 | TSL:2 | c.846_868delCAGCCTGAGACTGAAAGCAAAGC | p.Ser283AlafsTer48 | frameshift | Exon 7 of 7 | ENSP00000347004.2 | Q99697-1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at