chr4-110618210-TGCTTTGCTTTCAGTCTCAGGCTG-T

Variant names:

• chr4-110618210-TGCTTTGCTTTCAGTCTCAGGCTG-T
• NM_000325.6:c.867_889delCAGCCTGAGACTGAAAGCAAAGC

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The NM_000325.6(PITX2):​c.867_889delCAGCCTGAGACTGAAAGCAAAGC​(p.Ser290AlafsTer48) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: PITX2 NM_000325.6 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 10.0
• Publications: 0 publications found

Genes affected

PITX2 (HGNC:9005): (paired like homeodomain 2) This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

PITX2 Gene-Disease associations (from GenCC):

• anterior segment dysgenesis 4

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• Axenfeld-Rieger syndrome type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• ring dermoid of cornea

  Inheritance: AD, Unknown Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae)
• aniridia

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• Axenfeld anomaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Axenfeld-Rieger syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial atrial fibrillation

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Rieger anomaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Peters anomaly

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.111 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PP5: Variant 4-110618210-TGCTTTGCTTTCAGTCTCAGGCTG-T is Pathogenic according to our data. Variant chr4-110618210-TGCTTTGCTTTCAGTCTCAGGCTG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 1693129.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000325.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PITX2	NM_000325.6	MANE Select	c.867_889delCAGCCTGAGACTGAAAGCAAAGC	p.Ser290AlafsTer48	frameshift	Exon 3 of 3	NP_000316.2
	PITX2	NM_001204397.2		c.846_868delCAGCCTGAGACTGAAAGCAAAGC	p.Ser283AlafsTer48	frameshift	Exon 6 of 6	NP_001191326.1	Q99697-1
	PITX2	NM_001204398.1		c.846_868delCAGCCTGAGACTGAAAGCAAAGC	p.Ser283AlafsTer48	frameshift	Exon 5 of 5	NP_001191327.1	Q99697-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PITX2	ENST00000644743.1	MANE Select	c.867_889delCAGCCTGAGACTGAAAGCAAAGC	p.Ser290AlafsTer48	frameshift	Exon 3 of 3	ENSP00000495061.1	Q99697-2
	PITX2	ENST00000355080.9	TSL:1	c.708_730delCAGCCTGAGACTGAAAGCAAAGC	p.Ser237AlafsTer48	frameshift	Exon 4 of 4	ENSP00000347192.5	Q99697-3
	PITX2	ENST00000354925.6	TSL:2	c.846_868delCAGCCTGAGACTGAAAGCAAAGC	p.Ser283AlafsTer48	frameshift	Exon 7 of 7	ENSP00000347004.2	Q99697-1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Axenfeld-Rieger syndrome type 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=1/199	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr4-111539366;