4-112644886-GTAAAGGAACCAATTTTTAGATATGGTTGCCTT-G

Variant names:

• chr4-112644886-GTAAAGGAACCAATTTTTAGATATGGTTGCCTT-G
• rs1272425000
• NM_016648.4:c.202+20_202+51delGGAACCAATTTTTAGATATGGTTGCCTTTAAA

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2 BP6_Moderate

The NM_016648.4(LARP7):​c.202+20_202+51delGGAACCAATTTTTAGATATGGTTGCCTTTAAA variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000648 in 1,234,466 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000065 (0 hom.)
• Consequence: LARP7 NM_016648.4 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.92

Genes affected

LARP7 (HGNC:24912): (La ribonucleoprotein 7, transcriptional regulator) This gene encodes a protein which is found in the 7SK snRNP (small nuclear ribonucleoprotein). This snRNP complex inhibits a cyclin-dependent kinase, positive transcription elongation factor b, which is required for paused RNA polymerase II at a promoter to begin transcription elongation. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 4-112644886-GTAAAGGAACCAATTTTTAGATATGGTTGCCTT-G is Benign according to our data. Variant chr4-112644886-GTAAAGGAACCAATTTTTAGATATGGTTGCCTT-G is described in ClinVar as [Likely_benign]. Clinvar id is 1970781.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LARP7	NM_016648.4	c.202+20_202+51delGGAACCAATTTTTAGATATGGTTGCCTTTAAA		intron_variant	Intron 2 of 12	ENST00000344442.10	NP_057732.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LARP7	ENST00000344442.10	c.202+16_202+47delTAAAGGAACCAATTTTTAGATATGGTTGCCTT		intron_variant	Intron 2 of 12	2	NM_016648.4	ENSP00000344950.5

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000648 AC: 8 AN: 1234466 Hom.: 0 AF XY: 0.0000114 AC XY: 7 AN XY: 615548

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000832

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

Bravo AF: 0.00000378

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Jun 14, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1272425000; hg19: chr4-113566042;