4-119245325-CCTGTTTTTTAGGTTTTATGGCAATTGGATATATT-C

Variant names:

• chr4-119245325-CCTGTTTTTTAGGTTTTATGGCAATTGGATATATT-C
• NM_001371395.1:c.145-10_168delTGTTTTTTAGGTTTTATGGCAATTGGATATATTC

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Moderate PM2 PP5_Moderate

The NM_001371395.1(USP53):​c.145-10_168delTGTTTTTTAGGTTTTATGGCAATTGGATATATTC​(p.Val49_Arg57del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: USP53 NM_001371395.1 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 8.84

Genes affected

USP53 (HGNC:29255): (ubiquitin specific peptidase 53) Predicted to enable thiol-dependent deubiquitinase. Predicted to be involved in response to auditory stimulus and sensory perception of sound. Predicted to act upstream of or within action potential and neuron apoptotic process. Predicted to be located in bicellular tight junction. Predicted to be active in cell-cell junction. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.02886406 fraction of the gene. Cryptic splice site detected, with MaxEntScore 3.4, offset of 29, new splice context is: tgactggacatgtttgtcAGgga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-119245325-CCTGTTTTTTAGGTTTTATGGCAATTGGATATATT-C is Pathogenic according to our data. Variant chr4-119245325-CCTGTTTTTTAGGTTTTATGGCAATTGGATATATT-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3064438.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
USP53	NM_001371395.1	c.145-10_168delTGTTTTTTAGGTTTTATGGCAATTGGATATATTC	p.Val49_Arg57del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 6 of 19	ENST00000692078.1	NP_001358324.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
USP53	ENST00000692078.1	c.145-11_167delCTGTTTTTTAGGTTTTATGGCAATTGGATATATT	p.Val49fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 6 of 19		NM_001371395.1	ENSP00000509606.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Cholestasis, progressive familial intrahepatic, 7, with or without hearing loss Pathogenic:1

Mar 25, 2024

Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

USP53-related disorder Pathogenic:1

Mar 26, 2024

PreventionGenetics, part of Exact Sciences

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The USP53 c.145-10_168del34 variant is predicted to result in a frameshift and premature protein termination (p.Val49Profs*41). To our knowledge, this variant has not been reported in the literature or in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. Frameshift variants in USP53 are expected to be pathogenic. This variant is interpreted as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-120166480;