4-154584089-A-AGAAGACAGAGTGCTCCCATTCCCACTTC

Variant names:

• chr4-154584089-A-AGAAGACAGAGTGCTCCCATTCCCACTTC
• rs148317511
• NM_000508.5:c.*7_*34dupGAAGTGGGAATGGGAGCACTCTGTCTTC

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BA1

The NM_000508.5(FGA):​c.*7_*34dupGAAGTGGGAATGGGAGCACTCTGTCTTC variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.237 in 1,366,810 control chromosomes in the GnomAD database, including 46,544 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.29 (6505 hom., cov: 29)
  • Exomes 𝑓: 0.23 (40039 hom.)
• Consequence: FGA NM_000508.5 3_prime_UTR
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: -0.894
• Publications: 1 publications found

Genes affected

FGA (HGNC:3661): (fibrinogen alpha chain) This gene encodes the alpha subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Following vascular injury, the encoded preproprotein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia, afibrinogenemia and renal amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. [provided by RefSeq, Jan 2016]

FGA Gene-Disease associations (from GenCC):

• familial dysfibrinogenemia

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• congenital afibrinogenemia

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• congenital fibrinogen deficiency

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• familial visceral amyloidosis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• thrombophilia

  Inheritance: AR, AD Classification: STRONG Submitted by: Genomics England PanelApp
• AFib amyloidosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial hypofibrinogenemia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 4-154584089-A-AGAAGACAGAGTGCTCCCATTCCCACTTC is Benign according to our data. Variant chr4-154584089-A-AGAAGACAGAGTGCTCCCATTCCCACTTC is described in ClinVar as [Benign]. Clinvar id is 256327.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.42 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FGA	NM_000508.5	c.*7_*34dupGAAGTGGGAATGGGAGCACTCTGTCTTC		3_prime_UTR_variant	Exon 6 of 6		NP_000499.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FGA	ENST00000651975.2	c.*7_*34dupGAAGTGGGAATGGGAGCACTCTGTCTTC		3_prime_UTR_variant	Exon 6 of 6			ENSP00000498441.1

Frequencies

GnomAD3 genomes AF: 0.289 AC: 43484 AN: 150588 Hom.: 6494 Cov.: 29

Gnomad AFR AF: 0.357

Gnomad AMI AF: 0.252

Gnomad AMR AF: 0.242

Gnomad ASJ AF: 0.181

Gnomad EAS AF: 0.435

Gnomad SAS AF: 0.295

Gnomad FIN AF: 0.304

Gnomad MID AF: 0.212

Gnomad NFE AF: 0.252

Gnomad OTH AF: 0.256

GnomAD4 exome AF: 0.231 AC: 280324 AN: 1216106 Hom.: 40039 Cov.: 24 AF XY: 0.235 AC XY: 145086 AN XY: 616588

African (AFR) AF: 0.329 AC: 9092 AN: 27620

American (AMR) AF: 0.240 AC: 10664 AN: 44416

Ashkenazi Jewish (ASJ) AF: 0.175 AC: 4356 AN: 24822

East Asian (EAS) AF: 0.463 AC: 17696 AN: 38260

South Asian (SAS) AF: 0.314 AC: 25339 AN: 80816

European-Finnish (FIN) AF: 0.313 AC: 16579 AN: 52934

Middle Eastern (MID) AF: 0.190 AC: 803 AN: 4216

European-Non Finnish (NFE) AF: 0.206 AC: 183943 AN: 890810

Other (OTH) AF: 0.227 AC: 11852 AN: 52212

GnomAD4 genome AF: 0.289 AC: 43527 AN: 150704 Hom.: 6505 Cov.: 29 AF XY: 0.289 AC XY: 21284 AN XY: 73542

African (AFR) AF: 0.357 AC: 14628 AN: 40936

American (AMR) AF: 0.242 AC: 3654 AN: 15122

Ashkenazi Jewish (ASJ) AF: 0.181 AC: 627 AN: 3468

East Asian (EAS) AF: 0.435 AC: 2204 AN: 5066

South Asian (SAS) AF: 0.296 AC: 1395 AN: 4720

European-Finnish (FIN) AF: 0.304 AC: 3171 AN: 10426

Middle Eastern (MID) AF: 0.204 AC: 60 AN: 294

European-Non Finnish (NFE) AF: 0.252 AC: 17029 AN: 67680

Other (OTH) AF: 0.254 AC: 531 AN: 2088

Alfa AF: 0.211 Hom.: 593

ClinVar

Significance: Benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

-

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Benign:1

May 12, 2021

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.89
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs148317511; hg19: chr4-155505241; COSMIC: COSV57393473; COSMIC: COSV57393473;