chr4-154584089-A-AGAAGACAGAGTGCTCCCATTCCCACTTC
Variant summary
Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_StrongBA1
The NM_000508.5(FGA):c.*7_*34dupGAAGTGGGAATGGGAGCACTCTGTCTTC variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.237 in 1,366,810 control chromosomes in the GnomAD database, including 46,544 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).
Frequency
Consequence
NM_000508.5 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- familial dysfibrinogenemiaInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- congenital afibrinogenemiaInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet
- congenital fibrinogen deficiencyInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- familial visceral amyloidosisInheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- thrombophiliaInheritance: AR, AD Classification: STRONG Submitted by: Genomics England PanelApp
- AFib amyloidosisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial hypofibrinogenemiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000508.5. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes AF: 0.289 AC: 43484AN: 150588Hom.: 6494 Cov.: 29 show subpopulations
GnomAD4 exome AF: 0.231 AC: 280324AN: 1216106Hom.: 40039 Cov.: 24 AF XY: 0.235 AC XY: 145086AN XY: 616588 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.289 AC: 43527AN: 150704Hom.: 6505 Cov.: 29 AF XY: 0.289 AC XY: 21284AN XY: 73542 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at