4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
Variant summary
Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_ModerateBS1BS2
The NM_001388492.1(HTT):c.96_110dupGCAGCAGCAGCAGCA(p.Gln33_Gln37dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).
Frequency
Consequence
NM_001388492.1 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Huntington diseaseInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
- Lopes-Maciel-Rodan syndromeInheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- juvenile Huntington diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001388492.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HTT | NM_001388492.1 | MANE Select | c.96_110dupGCAGCAGCAGCAGCA | p.Gln33_Gln37dup | disruptive_inframe_insertion | Exon 1 of 67 | NP_001375421.1 | ||
| HTT | NM_002111.8 | c.96_110dupGCAGCAGCAGCAGCA | p.Gln33_Gln37dup | disruptive_inframe_insertion | Exon 1 of 67 | NP_002102.4 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HTT | ENST00000355072.11 | TSL:1 MANE Select | c.96_110dupGCAGCAGCAGCAGCA | p.Gln33_Gln37dup | disruptive_inframe_insertion | Exon 1 of 67 | ENSP00000347184.5 | ||
| HTT | ENST00000680291.1 | n.241_255dupGCAGCAGCAGCAGCA | non_coding_transcript_exon | Exon 1 of 41 | |||||
| HTT | ENST00000681528.1 | c.6-12018_6-12004dupGCAGCAGCAGCAGCA | intron | N/A | ENSP00000506116.1 |
Frequencies
GnomAD3 genomes AF: 0.0212 AC: 2796AN: 131774Hom.: 67 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.00763 AC: 9353AN: 1225532Hom.: 69 Cov.: 0 AF XY: 0.00806 AC XY: 4897AN XY: 607938 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0212 AC: 2796AN: 131872Hom.: 67 Cov.: 0 AF XY: 0.0201 AC XY: 1274AN XY: 63422 show subpopulations
Age Distribution
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at