4-41745975-TGCCGCCGCTGCCGCTGCCGCC-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCTGCCGCC
Variant summary
Our verdict is Likely pathogenic. The variant received 7 ACMG points: 8P and 1B. PP5_Very_StrongBP3
The NM_003924.4(PHOX2B):c.756_776dupGGCGGCAGCGGCAGCGGCGGC(p.Ala253_Ala259dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. A259A) has been classified as Likely benign.
Frequency
Consequence
NM_003924.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- central hypoventilation syndrome, congenital, 1, with or without Hirschsprung diseaseInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), G2P
- Haddad syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- neuroblastoma, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
- congenital central hypoventilation syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 7 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003924.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PHOX2B | NM_003924.4 | MANE Select | c.756_776dupGGCGGCAGCGGCAGCGGCGGC | p.Ala253_Ala259dup | disruptive_inframe_insertion | Exon 3 of 3 | NP_003915.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PHOX2B | ENST00000226382.4 | TSL:1 MANE Select | c.756_776dupGGCGGCAGCGGCAGCGGCGGC | p.Ala253_Ala259dup | disruptive_inframe_insertion | Exon 3 of 3 | ENSP00000226382.2 | Q99453 | |
| PHOX2B | ENST00000510424.2 | TSL:3 | n.*37_*57dupGGCGGCAGCGGCAGCGGCGGC | downstream_gene | N/A |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 8.77e-7 AC: 1AN: 1140480Hom.: 0 Cov.: 31 AF XY: 0.00000181 AC XY: 1AN XY: 551176 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at