chr4-41745975-T-TGCCGCCGCTGCCGCTGCCGCC

Variant names:

• chr4-41745975-T-TGCCGCCGCTGCCGCTGCCGCC
• rs17879189
• NM_003924.4:c.756_776dupGGCGGCAGCGGCAGCGGCGGC

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 8P and 1B. PP5_Very_Strong BP3

The NM_003924.4(PHOX2B):​c.756_776dupGGCGGCAGCGGCAGCGGCGGC​(p.Ala253_Ala259dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. A259A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 8.8e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PHOX2B NM_003924.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 1.60
• Publications: 1 publications found

Genes affected

PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

PHOX2B Gene-Disease associations (from GenCC):

• central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), G2P
• Haddad syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• neuroblastoma, susceptibility to, 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
• congenital central hypoventilation syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

• PP5: Variant 4-41745975-T-TGCCGCCGCTGCCGCTGCCGCC is Pathogenic according to our data. Variant chr4-41745975-T-TGCCGCCGCTGCCGCTGCCGCC is described in ClinVar as Pathogenic. ClinVar VariationId is 452239.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BP3: Nonframeshift variant in repetitive region in NM_003924.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003924.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PHOX2B	NM_003924.4	MANE Select	c.756_776dupGGCGGCAGCGGCAGCGGCGGC	p.Ala253_Ala259dup	disruptive_inframe_insertion	Exon 3 of 3	NP_003915.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PHOX2B	ENST00000226382.4	TSL:1 MANE Select	c.756_776dupGGCGGCAGCGGCAGCGGCGGC	p.Ala253_Ala259dup	disruptive_inframe_insertion	Exon 3 of 3	ENSP00000226382.2	Q99453
	PHOX2B	ENST00000510424.2	TSL:3	n.*37_*57dupGGCGGCAGCGGCAGCGGCGGC		downstream_gene	N/A

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 8.77e-7 AC: 1 AN: 1140480 Hom.: 0 Cov.: 31 AF XY: 0.00000181 AC XY: 1 AN XY: 551176

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 23570

American (AMR) AF: 0.00 AC: 0 AN: 10802

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16722

East Asian (EAS) AF: 0.00 AC: 0 AN: 25104

South Asian (SAS) AF: 0.00 AC: 0 AN: 30012

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 31492

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3286

European-Non Finnish (NFE) AF: 0.00000105 AC: 1 AN: 954344

Other (OTH) AF: 0.00 AC: 0 AN: 45148

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	PHOX2B-related disorder (2)
1	-	-	Neuroblastoma, susceptibility to, 2;C5562075:Central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6
Mutation Taster		=65/35	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs17879189; hg19: chr4-41747992;