4-41745975-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCCGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC

Variant names:

• chr4-41745975-T-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC
• rs757020181
• NM_003924.4:c.738_776dupGGCCGCGGCAGCGGCGGCGGCGGCAGCGGCAGCGGCGGC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PM2 PP5_Very_Strong

The NM_003924.4(PHOX2B):​c.738_776dupGGCCGCGGCAGCGGCGGCGGCGGCAGCGGCAGCGGCGGC​(p.Ala247_Ala259dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PHOX2B NM_003924.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 1.60

Genes affected

PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-41745975-T-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC is Pathogenic according to our data. Variant chr4-41745975-T-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC is described in ClinVar as [Pathogenic]. Clinvar id is 984923.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PHOX2B	NM_003924.4	c.738_776dupGGCCGCGGCAGCGGCGGCGGCGGCAGCGGCAGCGGCGGC	p.Ala247_Ala259dup	disruptive_inframe_insertion	Exon 3 of 3	ENST00000226382.4	NP_003915.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PHOX2B	ENST00000226382.4	c.738_776dupGGCCGCGGCAGCGGCGGCGGCGGCAGCGGCAGCGGCGGC	p.Ala247_Ala259dup	disruptive_inframe_insertion	Exon 3 of 3	1	NM_003924.4	ENSP00000226382.2
PHOX2B	ENST00000510424.2	n.*19_*57dupGGCCGCGGCAGCGGCGGCGGCGGCAGCGGCAGCGGCGGC		downstream_gene_variant		3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

PHOX2B-related disorder Pathogenic:1

Mar 13, 2024

PreventionGenetics, part of Exact Sciences

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The PHOX2B c.738_776dup39 variant is predicted to result in an in-frame duplication (p.Ala248_Ala260dup). This duplication causes an expansion of the polyalanine repeat region from 20 polyalanine repeats (normal) to 33 repeats, which is consistent with a diagnosis of congenital central hypoventilation syndrome (Sasaki et al. 2003. PubMed ID: 14566559; Matera et al. 2004. PubMed ID: 15121777). This variant is interpreted as pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1

Jan 17, 2018

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Ala241[33] pathogenic mutation, located in coding exon 3 of the PHOX2B gene, results from an expansion of the polyalanine repeat region from 20 to 33 repeats. This expansion mutation is associated with congenital central hypoventilation syndrome (Matera I et al. J. Med. Genet., 2004 May;41:373-80). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -

Congenital central hypoventilation Pathogenic:1

Jan 16, 2020

Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is located within the polyalanine tract in exon 3 of the PHOX2B gene and is expected to result in an expansion event. Repeat expansions within the polyalanine tract in the PHOX2B gene are an established mechanism of disease and have been previously reported in patients with Congenital Central Hypoventilation Syndrome (PMID: 12640453, 14566559, 14608649, 15121777). Analysis of the parental samples showed the mother is negative and the father is negative for this variant. Orthogonal confirmation is pending. Based on the available evidence, the c.738_776dup (p.Ala248_Ala260dup) variant is classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs757020181; hg19: chr4-41747992;