rs757020181

Positions:

• chr4-41745975-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC-T
• chr4-41745975-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCCGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_003924.4(PHOX2B):​c.738_776del​(p.Ala248_Ala260del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000636 in 1,288,314 control chromosomes in the GnomAD database, including 58 homozygotes. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. A246A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00085 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00061 (58 hom.)
• Consequence: PHOX2B NM_003924.4 inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 3.23

Genes affected

PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant 4-41745975-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC-T is Benign according to our data. Variant chr4-41745975-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC-T is described in ClinVar as [Likely_benign]. Clinvar id is 239590.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr4-41745975-TGCCGCCGCTGCCGCTGCCGCCGCCGCCGCTGCCGCGGCC-T is described in Lovd as [Pathogenic].
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.000845 (125/147848) while in subpopulation AMR AF= 0.00328 (49/14952). AF 95% confidence interval is 0.00255. There are 0 homozygotes in gnomad4. There are 65 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 125 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
PHOX2B	NM_003924.4	c.738_776del	p.Ala248_Ala260del	inframe_deletion	3/3	ENST00000226382.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
PHOX2B	ENST00000226382.4	c.738_776del	p.Ala248_Ala260del	inframe_deletion	3/3	1	NM_003924.4	P1
PHOX2B	ENST00000510424.2			downstream_gene_variant		3

Frequencies

GnomAD3 genomes AF: 0.000839 AC: 124 AN: 147736 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000832

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00328

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000425

Gnomad SAS AF: 0.000420

Gnomad FIN AF: 0.000214

Gnomad MID AF: 0.00645

Gnomad NFE AF: 0.000467

Gnomad OTH AF: 0.000980

GnomAD3 exomes AF: 0.00280 AC: 143 AN: 51026 Hom.: 26 AF XY: 0.00228 AC XY: 70 AN XY: 30750

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0438

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00195

Gnomad SAS exome AF: 0.00250

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000867

Gnomad OTH exome AF: 0.000924

GnomAD4 exome AF: 0.000609 AC: 694 AN: 1140466 Hom.: 58 AF XY: 0.000620 AC XY: 342 AN XY: 551168

Gnomad4 AFR exome AF: 0.000552

Gnomad4 AMR exome AF: 0.0165

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000558

Gnomad4 SAS exome AF: 0.00273

Gnomad4 FIN exome AF: 0.000254

Gnomad4 NFE exome AF: 0.000373

Gnomad4 OTH exome AF: 0.000842

GnomAD4 genome AF: 0.000845 AC: 125 AN: 147848 Hom.: 0 Cov.: 32 AF XY: 0.000903 AC XY: 65 AN XY: 72020

Gnomad4 AFR AF: 0.000854

Gnomad4 AMR AF: 0.00328

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000426

Gnomad4 SAS AF: 0.000420

Gnomad4 FIN AF: 0.000214

Gnomad4 NFE AF: 0.000467

Gnomad4 OTH AF: 0.000970

Alfa AF: 0.000367 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Likely benign, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Jan 01, 2024	PHOX2B: BS2 -
Benign, criteria provided, single submitter	clinical testing	GeneDx	Feb 14, 2019	This variant is associated with the following publications: (PMID: 26375764) -

Hereditary cancer-predisposing syndrome Benign:2

Likely benign, criteria provided, single submitter	clinical testing	Ambry Genetics	Sep 08, 2017	Other strong data supporting benign classification -
Benign, criteria provided, single submitter	curation	Sema4, Sema4	Oct 26, 2020	- -

Haddad syndrome Benign:1

Benign, criteria provided, single submitter

clinical testing

Invitae

Jan 26, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs757020181; hg19: chr4-41747992;