4-41745990-T-TGCCGCCGCCGCCGCTGCCGCG
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PP5_ModerateBP3
The NM_003924.4(PHOX2B):c.741_761dupCGCGGCAGCGGCGGCGGCGGC(p.Ala248_Ala254dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A254A) has been classified as Likely benign.
Frequency
Consequence
NM_003924.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- central hypoventilation syndrome, congenital, 1, with or without Hirschsprung diseaseInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
- Haddad syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- neuroblastoma, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
- congenital central hypoventilation syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PHOX2B | ENST00000226382.4 | c.741_761dupCGCGGCAGCGGCGGCGGCGGC | p.Ala248_Ala254dup | disruptive_inframe_insertion | Exon 3 of 3 | 1 | NM_003924.4 | ENSP00000226382.2 | ||
PHOX2B | ENST00000510424.2 | n.*22_*42dupCGCGGCAGCGGCGGCGGCGGC | downstream_gene_variant | 3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome Pathogenic:1
The p.Ala241[27] pathogenic mutation, located in coding exon 3 of the PHOX2B gene, results from an expansion of the polyalanine repeat region from 20 to 27 repeats. This expansion mutation is associated with congenital central hypoventilation syndrome (Amiel J et al. Nat. Genet., 2003 Apr;33:459-61; Matera I et al. J. Med. Genet., 2004 May;41:373-80). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at