chr4-41745990-T-TGCCGCCGCCGCCGCTGCCGCG

Variant names:

• chr4-41745990-T-TGCCGCCGCCGCCGCTGCCGCG
• NM_003924.4:c.741_761dupCGCGGCAGCGGCGGCGGCGGC

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM2 PP5_Moderate BP3

The NM_003924.4(PHOX2B):​c.741_761dupCGCGGCAGCGGCGGCGGCGGC​(p.Ala248_Ala254dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A254A) has been classified as Benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PHOX2B NM_003924.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.11

Genes affected

PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-41745990-T-TGCCGCCGCCGCCGCTGCCGCG is Pathogenic according to our data. Variant chr4-41745990-T-TGCCGCCGCCGCCGCTGCCGCG is described in ClinVar as [Pathogenic]. Clinvar id is 1758788.Status of the report is criteria_provided_single_submitter, 1 stars.
• BP3: Nonframeshift variant in repetitive region in NM_003924.4

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PHOX2B	NM_003924.4	c.741_761dupCGCGGCAGCGGCGGCGGCGGC	p.Ala248_Ala254dup	disruptive_inframe_insertion	Exon 3 of 3	ENST00000226382.4	NP_003915.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PHOX2B	ENST00000226382.4	c.741_761dupCGCGGCAGCGGCGGCGGCGGC	p.Ala248_Ala254dup	disruptive_inframe_insertion	Exon 3 of 3	1	NM_003924.4	ENSP00000226382.2
PHOX2B	ENST00000510424.2	n.*22_*42dupCGCGGCAGCGGCGGCGGCGGC		downstream_gene_variant		3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Jun 28, 2022

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Ala241[27] pathogenic mutation, located in coding exon 3 of the PHOX2B gene, results from an expansion of the polyalanine repeat region from 20 to 27 repeats. This expansion mutation is associated with congenital central hypoventilation syndrome (Amiel J et al. Nat. Genet., 2003 Apr;33:459-61; Matera I et al. J. Med. Genet., 2004 May;41:373-80). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-41748007;