4-54657917-C-CCGCTCGCGGCTCTGGGGGCTCGGCTTTGCCGCGCTCGCTGCACTTGGGCGAGAGCTGGAACGTGGACCAGAGCTCGGATCCCATCGCAGCTACCGCGATGAGAGG

Variant names:

• chr4-54657917-C-CCGCTCGCGGCTCTGGGGGCTCGGCTTTGCCGCGCTCGCTGCACTTGGGCGAGAGCTGGAACGTGGACCAGAGCTCGGATCCCATCGCAGCTACCGCGATGAGAGG
• ENST00000288135.6:c.-87_18dupTCTGGGGGCTCGGCTTTGCCGCGCTCGCTGCACTTGGGCGAGAGCTGGAACGTGGACCAGAGCTCGGATCCCATCGCAGCTACCGCGATGAGAGGCGCTCGCGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The ENST00000288135.6(KIT):​c.-87_18dupTCTGGGGGCTCGGCTTTGCCGCGCTCGCTGCACTTGGGCGAGAGCTGGAACGTGGACCAGAGCTCGGATCCCATCGCAGCTACCGCGATGAGAGGCGCTCGCGGC​(p.Gly6_Ala7insSerGlyGlySerAlaLeuProArgSerLeuHisLeuGlyGluSerTrpAsnValAspGlnSerSerAspProIleAlaAlaThrAlaMetArgGlyAlaArgGly) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A7A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: KIT ENST00000288135.6 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.417
• Publications: 0 publications found

Genes affected

KIT (HGNC:6342): (KIT proto-oncogene, receptor tyrosine kinase) This gene encodes a receptor tyrosine kinase. This gene was initially identified as a homolog of the feline sarcoma viral oncogene v-kit and is often referred to as proto-oncogene c-Kit. The canonical form of this glycosylated transmembrane protein has an N-terminal extracellular region with five immunoglobulin-like domains, a transmembrane region, and an intracellular tyrosine kinase domain at the C-terminus. Upon activation by its cytokine ligand, stem cell factor (SCF), this protein phosphorylates multiple intracellular proteins that play a role in in the proliferation, differentiation, migration and apoptosis of many cell types and thereby plays an important role in hematopoiesis, stem cell maintenance, gametogenesis, melanogenesis, and in mast cell development, migration and function. This protein can be a membrane-bound or soluble protein. Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous leukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]

KIT Gene-Disease associations (from GenCC):

• gastrointestinal stromal tumor

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Ambry Genetics
• piebaldism

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• cutaneous mastocytosis

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• mastocytosis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in ENST00000288135.6.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KIT	NM_000222.3	c.-98_-97insCGCTCGCGGCTCTGGGGGCTCGGCTTTGCCGCGCTCGCTGCACTTGGGCGAGAGCTGGAACGTGGACCAGAGCTCGGATCCCATCGCAGCTACCGCGATGAGAGG		upstream_gene_variant		ENST00000288135.6	NP_000213.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KIT	ENST00000288135.6	c.-87_18dupTCTGGGGGCTCGGCTTTGCCGCGCTCGCTGCACTTGGGCGAGAGCTGGAACGTGGACCAGAGCTCGGATCCCATCGCAGCTACCGCGATGAGAGGCGCTCGCGGC	p.Gly6_Ala7insSerGlyGlySerAlaLeuProArgSerLeuHisLeuGlyGluSerTrpAsnValAspGlnSerSerAspProIleAlaAlaThrAlaMetArgGlyAlaArgGly	conservative_inframe_insertion	Exon 1 of 21	1	NM_000222.3	ENSP00000288135.6
KIT	ENST00000288135.6	c.-98_-97insCGCTCGCGGCTCTGGGGGCTCGGCTTTGCCGCGCTCGCTGCACTTGGGCGAGAGCTGGAACGTGGACCAGAGCTCGGATCCCATCGCAGCTACCGCGATGAGAGG		upstream_gene_variant		1	NM_000222.3	ENSP00000288135.6

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 15

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Gastrointestinal stromal tumor Uncertain:1

Nov 20, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant occurs in a non-coding region of the KIT gene. It does not change the encoded amino acid sequence of the KIT protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with KIT-related conditions. This variant is also known as p.Gly6_Ala7ins35. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.42

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr4-55524084;