5-135028924-GGAGTGCCGTACGGGCAAGCGCCCGGCGACATGGCC-G

Variant names:

• chr5-135028924-GGAGTGCCGTACGGGCAAGCGCCCGGCGACATGGCC-G
• rs730882191
• NM_002653.5:c.765_799delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_Strong PP5

The NM_002653.5(PITX1):​c.765_799delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC​(p.Ala256ArgfsTer304) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 34)
• Consequence: PITX1 NM_002653.5 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.79
• Publications: 1 publications found

Genes affected

PITX1 (HGNC:9004): (paired like homeodomain 1) This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]

PITX1 Gene-Disease associations (from GenCC):

• clubfoot

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• brachydactyly-elbow wrist dysplasia syndrome

  Inheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.19 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
• PP5: Variant 5-135028924-GGAGTGCCGTACGGGCAAGCGCCCGGCGACATGGCC-G is Pathogenic according to our data. Variant chr5-135028924-GGAGTGCCGTACGGGCAAGCGCCCGGCGACATGGCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 37253.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PITX1	NM_002653.5	c.765_799delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC	p.Ala256ArgfsTer304	frameshift_variant	Exon 3 of 3	ENST00000265340.12	NP_002644.4
PITX1	XM_047417318.1	c.867_901delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC	p.Ala290ArgfsTer304	frameshift_variant	Exon 4 of 4		XP_047273274.1
PITX1	XM_047417319.1	c.420_454delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC	p.Ala141ArgfsTer304	frameshift_variant	Exon 3 of 3		XP_047273275.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PITX1	ENST00000265340.12	c.765_799delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC	p.Ala256ArgfsTer304	frameshift_variant	Exon 3 of 3	1	NM_002653.5	ENSP00000265340.6
PITX1	ENST00000506438.5	c.765_799delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC	p.Ala256ArgfsTer123	frameshift_variant	Exon 4 of 4	1		ENSP00000427542.1

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Clubfoot Pathogenic:1

Jun 01, 2012

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs730882191; hg19: chr5-134364614;