rs730882191
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_StrongPP5
The NM_002653.5(PITX1):c.765_799delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC(p.Ala256ArgfsTer304) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_002653.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- clubfootInheritance: AD Classification: STRONG, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- brachydactyly-elbow wrist dysplasia syndromeInheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002653.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PITX1 | TSL:1 MANE Select | c.765_799delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC | p.Ala256ArgfsTer304 | frameshift | Exon 3 of 3 | ENSP00000265340.6 | P78337 | ||
| PITX1 | TSL:1 | c.765_799delGGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC | p.Ala256ArgfsTer123 | frameshift | Exon 4 of 4 | ENSP00000427542.1 | P78337 |
Frequencies
GnomAD3 genomes Cov.: 34
GnomAD4 genome Cov.: 34
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.