5-138439205-C-CGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGT

Variant names:

• chr5-138439205-C-CGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGT
• ENST00000378339:c.-7_-6insGTGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGT

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001271803.2(REEP2):​c.-2_32+3dupCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGTG variant causes a splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: REEP2 NM_001271803.2 splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.37

Genes affected

REEP2 (HGNC:17975): (receptor accessory protein 2) This gene encodes a member of the receptor expression enhancing protein family. Studies of a related gene in mouse suggest that the encoded protein is found in the cell membrane and enhances the function of sweet taste receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
REEP2	NM_001271803.2	c.-2_32+3dupCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGTG		splice_region_variant, intron_variant	Intron 1 of 7	ENST00000378339.7	NP_001258732.1
REEP2	NM_016606.4	c.-2_32+3dupCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGTG		splice_region_variant, intron_variant	Intron 1 of 7		NP_057690.2
REEP2	NR_073448.2	n.151_184+3dupCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGTG		splice_region_variant, intron_variant	Intron 1 of 7
REEP2	NR_073449.2	n.151_184+3dupCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGTG		splice_region_variant, intron_variant	Intron 1 of 7

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
REEP2	ENST00000378339	c.-7_-6insGTGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGT		5_prime_UTR_variant	Exon 1 of 8	1	NM_001271803.2	ENSP00000367590.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jun 27, 2022

Kariminejad - Najmabadi Pathology & Genetics Center

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-137774894;