chr5-138439205-C-CGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGT

Variant names:

• chr5-138439205-C-CGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGT
• ENST00000378339.7:c.-76_-75insGTGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001271803.2(REEP2):​c.-2_32+3dupCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGTG variant causes a splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: REEP2 NM_001271803.2 splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.37
• Publications: 0 publications found

Genes affected

REEP2 (HGNC:17975): (receptor accessory protein 2) This gene encodes a member of the receptor expression enhancing protein family. Studies of a related gene in mouse suggest that the encoded protein is found in the cell membrane and enhances the function of sweet taste receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

REEP2 Gene-Disease associations (from GenCC):

• hereditary spastic paraplegia 72

  Inheritance: AD, AR, SD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet
• hereditary spastic paraplegia

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001271803.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	REEP2	NM_001271803.2	MANE Select	c.-2_32+3dupCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGTG		splice_region intron	N/A	NP_001258732.1	Q9BRK0-2
	REEP2	NM_016606.4		c.-2_32+3dupCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGTG		splice_region intron	N/A	NP_057690.2
	REEP2	NR_073448.2		n.151_184+3dupCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGTG		splice_region intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	REEP2	ENST00000378339.7	TSL:1 MANE Select	c.-76_-75insGTGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGT		5_prime_UTR	Exon 1 of 8	ENSP00000367590.2	Q9BRK0-2
	REEP2	ENST00000254901.9	TSL:1	c.-76_-75insGTGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGT		5_prime_UTR	Exon 1 of 8	ENSP00000254901.5	Q9BRK0-1
	REEP2	ENST00000903314.1		c.-76_-75insGTGCCATGGTGTCCTGGATCATCTCTCGCCTGGTGGT		5_prime_UTR	Exon 1 of 8	ENSP00000573373.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr5-137774894;