5-1394806-T-TTAAGAGCAGCTGAAGGTGGC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001044.5(SLC6A3):c.1840-68_1840-49dupGCCACCTTCAGCTGCTCTTA variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000619 in 1,453,664 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001044.5 intron
Scores
Clinical Significance
Conservation
Publications
- classic dopamine transporter deficiency syndromeInheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, PanelApp Australia, Ambry Genetics
- SLC6A3-related dopamine transporter deficiency syndromeInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- parkinsonism-dystonia, infantileInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001044.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SLC6A3 | TSL:1 MANE Select | c.1840-49_1840-48insGCCACCTTCAGCTGCTCTTA | intron | N/A | ENSP00000270349.9 | Q01959 | |||
| SLC6A3 | TSL:1 | n.221-49_221-48insGCCACCTTCAGCTGCTCTTA | intron | N/A | |||||
| SLC6A3 | c.1705-49_1705-48insGCCACCTTCAGCTGCTCTTA | intron | N/A | ENSP00000611849.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD2 exomes AF: 0.0000159 AC: 4AN: 251064 AF XY: 0.0000221 show subpopulations
GnomAD4 exome AF: 0.00000619 AC: 9AN: 1453664Hom.: 0 Cov.: 29 AF XY: 0.00000829 AC XY: 6AN XY: 723632 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at