5-1394806-TTAAGAGCAGCTGAAGGTGGC-T

Variant names:

• chr5-1394806-TTAAGAGCAGCTGAAGGTGGC-T
• rs374826498
• NM_001044.5:c.1840-68_1840-49delGCCACCTTCAGCTGCTCTTA

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BS1 BS2

The NM_001044.5(SLC6A3):​c.1840-68_1840-49delGCCACCTTCAGCTGCTCTTA variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000632 in 1,605,914 control chromosomes in the GnomAD database, including 7 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0032 (3 hom., cov: 33)
  • Exomes 𝑓: 0.00036 (4 hom.)
• Consequence: SLC6A3 NM_001044.5 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.90
• Publications: 0 publications found

Genes affected

SLC6A3 (HGNC:11049): (solute carrier family 6 member 3) This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]

SLC6A3 Gene-Disease associations (from GenCC):

• classic dopamine transporter deficiency syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• SLC6A3-related dopamine transporter deficiency syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• parkinsonism-dystonia, infantile

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 5-1394806-TTAAGAGCAGCTGAAGGTGGC-T is Benign according to our data. Variant chr5-1394806-TTAAGAGCAGCTGAAGGTGGC-T is described in ClinVar as [Likely_benign]. Clinvar id is 1201383.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.00323 (492/152258) while in subpopulation AFR AF = 0.0109 (453/41550). AF 95% confidence interval is 0.0101. There are 3 homozygotes in GnomAd4. There are 238 alleles in the male GnomAd4 subpopulation. Median coverage is 33. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 3 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC6A3	NM_001044.5	c.1840-68_1840-49delGCCACCTTCAGCTGCTCTTA		intron_variant	Intron 14 of 14	ENST00000270349.12	NP_001035.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC6A3	ENST00000270349.12	c.1840-68_1840-49delGCCACCTTCAGCTGCTCTTA		intron_variant	Intron 14 of 14	1	NM_001044.5	ENSP00000270349.9
SLC6A3	ENST00000512002.2	n.221-68_221-49delGCCACCTTCAGCTGCTCTTA		intron_variant	Intron 2 of 2	1
SLC6A3	ENST00000713696.1	c.*35-68_*35-49delGCCACCTTCAGCTGCTCTTA		intron_variant	Intron 14 of 14			ENSP00000519000.1

Frequencies

GnomAD3 genomes AF: 0.00319 AC: 485 AN: 152140 Hom.: 3 Cov.: 33

Gnomad AFR AF: 0.0108

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00183

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00316

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00335

GnomAD2 exomes AF: 0.000789 AC: 198 AN: 251064 AF XY: 0.000611

Gnomad AFR exome AF: 0.00977

Gnomad AMR exome AF: 0.000955

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000264

Gnomad OTH exome AF: 0.000490

GnomAD4 exome AF: 0.000360 AC: 523 AN: 1453656 Hom.: 4 AF XY: 0.000321 AC XY: 232 AN XY: 723628

African (AFR) AF: 0.0121 AC: 402 AN: 33316

American (AMR) AF: 0.000962 AC: 43 AN: 44700

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26082

East Asian (EAS) AF: 0.00 AC: 0 AN: 39666

South Asian (SAS) AF: 0.0000929 AC: 8 AN: 86088

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53350

Middle Eastern (MID) AF: 0.000349 AC: 2 AN: 5734

European-Non Finnish (NFE) AF: 0.00000996 AC: 11 AN: 1104644

Other (OTH) AF: 0.000949 AC: 57 AN: 60076

GnomAD4 genome AF: 0.00323 AC: 492 AN: 152258 Hom.: 3 Cov.: 33 AF XY: 0.00320 AC XY: 238 AN XY: 74456

African (AFR) AF: 0.0109 AC: 453 AN: 41550

American (AMR) AF: 0.00183 AC: 28 AN: 15306

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5162

South Asian (SAS) AF: 0.00 AC: 0 AN: 4822

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10620

Middle Eastern (MID) AF: 0.00340 AC: 1 AN: 294

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 68012

Other (OTH) AF: 0.00331 AC: 7 AN: 2112

Alfa AF: 0.00197 Hom.: 2

Asia WGS AF: 0.000866 AC: 3 AN: 3478

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Aug 25, 2018

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs374826498; hg19: chr5-1394921;