5-145859730-GGGCTATTGATTGCAAATCTGGCAA-G
Variant summary
Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2
The NM_001080516.2(GRXCR2):c.726_*2delTTGCCAGATTTGCAATCAATAGCC(p.Pro242_Ter249delins???) variant causes a stop lost, conservative inframe deletion change. The variant allele was found at a frequency of 0.0000198 in 1,613,682 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001080516.2 stop_lost, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 10 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
GRXCR2 | NM_001080516.2 | c.726_*2delTTGCCAGATTTGCAATCAATAGCC | p.Pro242_Ter249delins??? | stop_lost, conservative_inframe_deletion | Exon 3 of 3 | ENST00000377976.3 | NP_001073985.1 | |
GRXCR2 | NM_001080516.2 | c.725_*2delTTGCCAGATTTGCAATCAATAGCC | 3_prime_UTR_variant | Exon 3 of 3 | ENST00000377976.3 | NP_001073985.1 | ||
GRXCR2 | XM_017009708.2 | c.438_*2delTTGCCAGATTTGCAATCAATAGCC | p.Pro146_Ter153delins??? | stop_lost, conservative_inframe_deletion | Exon 3 of 3 | XP_016865197.1 | ||
GRXCR2 | XM_017009708.2 | c.437_*2delTTGCCAGATTTGCAATCAATAGCC | 3_prime_UTR_variant | Exon 3 of 3 | XP_016865197.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
GRXCR2 | ENST00000377976.3 | c.726_*2delTTGCCAGATTTGCAATCAATAGCC | p.Pro242_Ter249delins??? | stop_lost, conservative_inframe_deletion | Exon 3 of 3 | 2 | NM_001080516.2 | ENSP00000367214.1 | ||
GRXCR2 | ENST00000377976 | c.725_*2delTTGCCAGATTTGCAATCAATAGCC | 3_prime_UTR_variant | Exon 3 of 3 | 2 | NM_001080516.2 | ENSP00000367214.1 | |||
GRXCR2 | ENST00000639411.1 | c.321_*2delTTGCCAGATTTGCAATCAATAGCC | p.Pro107_Ter114delins??? | stop_lost, conservative_inframe_deletion | Exon 4 of 4 | 5 | ENSP00000491860.1 | |||
GRXCR2 | ENST00000639411 | c.320_*2delTTGCCAGATTTGCAATCAATAGCC | 3_prime_UTR_variant | Exon 4 of 4 | 5 | ENSP00000491860.1 |
Frequencies
GnomAD3 genomes AF: 0.0000460 AC: 7AN: 152150Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.0000279 AC: 7AN: 251190Hom.: 0 AF XY: 0.0000221 AC XY: 3AN XY: 135746
GnomAD4 exome AF: 0.0000171 AC: 25AN: 1461532Hom.: 0 AF XY: 0.0000234 AC XY: 17AN XY: 727088
GnomAD4 genome AF: 0.0000460 AC: 7AN: 152150Hom.: 0 Cov.: 32 AF XY: 0.0000538 AC XY: 4AN XY: 74316
ClinVar
Submissions by phenotype
not provided Uncertain:1
This sequence change creates a premature translational stop signal (p.Pro242_249del) in the GRXCR2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 7 amino acid(s) of the GRXCR2 protein. This variant is present in population databases (rs772716837, ExAC 0.009%). This variant has not been reported in the literature in individuals with GRXCR2-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at